Sanger product of the sequencing of a template DNA is presented below. It is the polymorphic peptide sequence of Protein Ser-Gly-Lys-Glu-Gly-Lys-Lys. Determine the sequence of template DNA and the mRNA sequence from this template DNA. Briefly explain.

Sanger product of the sequencing of a template DNA is presented below. It is the polymorphic peptide sequence of Protein Ser-Gly-Lys-Glu-Gly-Lys-Lys. Determine the sequence of template DNA and the mRNA sequence from this template DNA. Briefly explain.

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Related questions

Q: 5. Assume that you are trying to do a gel mobility shift experiment using a normal set of Trp genes.…

A: The gel mobility shift assay is a biochemistry technique used to detect protein complexes with DNA.…

Q: At which solvent is yeast RNA very soluble? Explain why. At which solvent/s is yeast RNA insoluble?…

A: RNA are ribose nucleic acids containing ribose sugar, nitrogenous bases, and phosphate group. These…

Q: The Shine-Dalgarno Sequence is used in bacteria eukaryotes both

A: The nucleotide segment at the 3' terminal of 16S ribosomal RNA (rRNA) has several pyrimidines with a…

Q: The team would now like to establish the smallest possible deletion that would inactivate the…

A: Amino acid monomers form the building blocks of proteins. The arrangement of amino acids makes up a…

Q: The E coli cell contains 107 non-specific DNA binding sites for R, 10 R molecules, and 1 Operator.…

A: In molecular biology, the particular binding of a regulatory protein to DNA could be a common…

Q: Human genomic libraries used for DNA sequencing are often made from fragments obtained by cleaving…

A: Genomic Libraries are a set of collections of genomic DNA data particular to a species/organism. The…

Q: Within living cells, many different proteins play importantfunctional roles by binding to DNA. Some…

A: Within the living cells, various proteins play an important role in function by binding to the DNA.…

Q: DNA helicases are involved in diverse cellular processes. List four examples of DNA helicases that…

A: DNA helicase enzyme This is the enzyme that is involved in the unwinding of the double helix…

Q: Draw the double-stranded sequence of each fragment after cleavage showing any phosphates left on the…

A: Restriction endonucleases cut double stranded DNA at specific site or near specific site and form…

Q: E. coli K12 genomic DNA (expected PCR product was 3075bp). For expression the gene was cloned into…

A: The information you provided suggests that a gene was cloned into the expression plasmid pET28a, and…

Q: Given the partial transposons DNA sequence 5’-ACCGTATTCGGT-3’ upstream from the central region,…

A: Transposons are the regions in the DNA molecule that can change their position within the genome.…

Q: The restriction endonuclease NciI recognizes and cuts the five-base-pair sequence 5’- CC(G/C)GG-3’…

A: Introduction: A bacterial protein termed restriction enzyme, also known as restriction endonuclease,…

Q: Explain the mechanism of trinucleotide repeat expansion.

A: Introduction: A trinucleotide repeat expansion is type of DNA mutation. In which, the trinucleotide…

Q: identify the type of DNA binding motif is shown and the characteristics.

A: DNA stands for deoxyribonucleic acid. A DNA-binding domain consists of a structural motif that…

Q: Assuming that it is exactly and only 5 nucleotides long, write the Shine-Dalgarno sequence in the…

A: Given: The shine- dalgano sequence is a ribosomal binding site that is found in bacterial and…

Q: The restriction enzymes KpnI and Acc65I recognize and cleave the same 6-bp sequence. However, the…

A: To answer this question we should have knowledge of Biotechnology

Q: Provide the sequences of the template and coding strands of a DNA double helix that was used to…

A: Introduction :- The template strand is a strand of DNA that serves as the blueprint for the…

Question

A Sanger product of the sequencing of a template DNA is presented below. It is the polymorphic peptide sequence of Protein Ser-Gly-Lys-Glu-Gly-Lys-Lys. Determine the sequence of template DNA and the mRNA sequence from this template DNA. Briefly explain.

Sanger products using ddGTP
Mononucleotide
Decanucleotide
Trinucleotide
12-nucleotide
Tetranucleotide
13-nucleotide
Pentanucleotide
14-nucleotide
Hexanucleotide
16-nucleotide
nonanucleotide
21-nucleotide

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

Step 2

Step 3

Step 4

Step by step

Solved in 4 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

The eukaryotic cell is different from the prokaryotic cell. Outline the structural difference between these two types of cell and suggest two reasons why eukaryotic mRNA needs to be modified before translation.
The 5′ sequence for the mRNA for E. coli ribosomal L10 protein is shownbelow. Identify the Shine–Dalgarno sequence and the initiator codon.5′¬CUACCAGGAGCAAAGCUAAUGGCUUUA¬3′
The abundance of three mRNA transcripts, transcripts A, B, and C, was measured by real-time PCR. The average CT values were 14.6, 20.2, and 10.5 for transcripts A, B, and C, respectively. Determine the relative order of abundance of the transcripts. Name one technique that could be used to confirm that the order of abundance at the mRNA transcript level is reflected at the protein level.
The mRNA formed from the repeating tetranucleotide UUACincorporates only three amino acids, but the use of UAUC incorporates four amino acids. Why?
Within living cells, many different proteins play importantfunctional roles by binding to DNA. Some proteins bind to DNA butnot in a sequence-specific manner. For example, histones are proteinsimportant in the formation of chromosome structure. The positivelycharged histone proteins bind to the negatively charged phosphategroups in DNA. In addition, several other proteins interact with DNAbut do not require a specific nucleotide sequence to carry out theirfunction. For example, DNA polymerase, which catalyzes thesynthesis of new DNA strands, does not bind to DNA in a sequencedependentmanner. By comparison, many other proteins do interactwith nucleic acids in a sequence-dependent fashion. This means that a specific sequence of bases can provide a structure that isrecognized by a particular protein.Someexamples include transcription factors that affect the rate oftranscription and proteins that bind to origins of replication inbacteria.What topic in genetics does this question address?
Briefly discuss (referring to the images provided) why mutant 2 fails to produce functional protein. Note that none of the mRNA transcribed from this gene is of the expected size; some of the mRNA molecules produced are 223 nucleotides shorter than expected, whilst others are 47 nucleotides longer than expected.
Kindly indicate which option is the correct answer. Thank you
Within living cells, many different proteins play importantfunctional roles by binding to DNA. Some proteins bind to DNA butnot in a sequence-specific manner. For example, histones are proteinsimportant in the formation of chromosome structure. The positivelycharged histone proteins bind to the negatively charged phosphategroups in DNA. In addition, several other proteins interact with DNAbut do not require a specific nucleotide sequence to carry out theirfunction. For example, DNA polymerase, which catalyzes thesynthesis of new DNA strands, does not bind to DNA in a sequencedependent manner. By comparison, many other proteins do interact with nucleic acids in a sequence-dependent fashion. This means that a specific sequence of bases can provide a structure that isrecognized by a particular protein.Someexamples include transcription factors that affect the rate oftranscription and proteins that bind to origins of replication inbacteria.What information do you know based onthe question…
Digestion of a DNA sample with Decll, which is a "4-cutter" enzyme that produces blunt (rather than "sticky") ends, generated numerous DNA fragments, including a 15 bp piece whose sequence is indicated below (note that only one of the DNA strands is specified). 5' TCTGAATTCCGTAGA 3' Based on this information, the recognition sequence for the Decll enzyme must be 5' 3. [specify using single letters]
In the following sequence, a cytosine was deaminated and is now a uracil (underlined). 5’-GGTAUTAAGC-3’ a. Which repair pathway(s) could restore this uracil to cytosine? b. If the uracil is not removed before a DNA replication fork passes through, what will be the sequences of the two resulting double helices? Provide the sequences of both strands of both helices. Label the old and new strands and underline the mutation(s). c. Could the mismatch repair pathway fix the mutations you’ve indicated in part b? d. If the cell undergoes mitosis, and the replicated DNAs are distributed into the two daughter cells. Will 0, 1, or 2 daughter cells have a mutation in this sequence?
Kpn I and Acc 65I are restriction enzymes that identify and cleave the same 6-bp sequence. The sticky end created by Kpn I cleavage, on the other hand, cannot be directly ligated to the sticky end formed by Acc 65I cleavage. Please explain why.
34) What amino acid sequence is coded for by the following DNA coding strand? (Recall: the DNA template strand runs 5' to 3' and the mRNA strand runs antiparallel to the DNA template strand. Recall that DNA is translated with a start codon.) 5'-TTATGCGACCAGACCAGTTT-3' Coding strand