Sanger product of the sequencing of a template DNA is presented below. It is the polymorphic peptide sequence of Protein Ser-Gly-Lys-Glu-Gly-Lys-Lys. Determine the sequence of template DNA and the mRNA sequence from this template DNA. Briefly explain.
Q: Shown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein…
A: Transcription is a process from central dogma where a DNA strand is used as a template to synthesize…
Q: If you set up an in vitro translation reaction containing poly(ACGU), as template, which of the…
A: A three-letter codon is a sequence of DNA or RNA that corresponds to a specific amino acid. These…
Q: As part of a project investigating potential new drug targets in the fight against malaria, you are…
A: Introduction:- Truncation of protein:- is meant by the proteolysis or structural gene manipulation…
Q: For the following mRNA sequence (reading from left to right) what will be the amino acid sequence…
A: Genetic code consists of four letters 'GACU' which stands for guanine, adenine, cytosine, and uracil…
Q: Examine the following mRNA transcripts: Wild type: 5' CACUGAUGCACGGAUCAU 3' Mutant: 5'…
A:
Q: Sequence: CUCAACACGCCGCUCAGUGCCCUCGUGAUGAAGCAUAGGGGAAAC By in vitro translating the mRNA, you…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: The template strand of wild-type gene A is shown below. On the space provided, type the translation…
A: Amino acids are known as the building blocks of protein. They are required for the synthesis of…
Q: Following is an mRNA sequence reported in data base. 5’ ACC AGA ATG ACC ATG GCA 3’ If there are…
A: Ribonucleic acid (RNA) also contains genetic material but rarely takes part in transferring the…
Q: Phenylalanine (Phe) is encoded by either UUU or UUC, while Tyrosine (Tyr) is encoded only by UAC and…
A: Given Phenylalanine (Phe) is encoded by either UUU or UUC, while Tyrosine (Tyr) is encoded only by…
Q: Consider the MRNA sequence below. Assume that the following mRNA segment has been translated.…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: A single base addition and a single base deletion approximately 15 bases apart in the mRNA…
A: The DNA (deoxyribonucleic acid) is the hereditary material of an organism. The gene comprises the…
Q: Given the following mRNA and amino acids, construct a polypeptide from this tRNA strand.…
A: This is the DNA which ultimately decides what amino acid sequences are going to be added to form a…
Q: The DNA sequence of a short gene from a sea slug, and the mature RNA synthesized from this gene, are…
A: The transcription is the process in which the mRNA copied information from DNA for protein…
Q: Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic…
A: An R-loop refers to a structure formed by a DNA (deoxyribonucleic acid) and an RNA molecule. As a…
Q: Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic…
A: An exon is any part of a gene that will encode a part of the final mature RNA produced by that gene…
Q: The wobble rules for tRNA-mRNA pairing are shown. If we assume that the tRNAs do not containmodified…
A: The pairing of tRNA anticodon with mRNA codon lead from the 5’ end of codon. The first 2 position…
Q: Consider the following wild-type and mutant sequences:Wild-type ....CTTGCAAGCGAATC....Mutant…
A: Deoxyribonucleic acid (DNA) is a biomolecule found in nearly all living organisms. The structure of…
Q: The coding sequences of Gene F and Gene G are shown by the double-stranded DNA below. Using the…
A: Genetic codes are stored in the form of trinucleotide sequences (codons) in the mRNA.The mRNA gets…
Q: mutant appear on a gel in comparison
A: Point mutations can cause serious changes to an organism if they change the way a protein works By…
Q: that the
A: Polypeptides, or proteins, are chemical compounds composed up of amino acids. They're big,…
Q: Examine the following mRNA transcripts: Wild type: 5' CACUGAUGCACGGAUCAU 3' Mutant: 5'…
A: Mutation is in 3rd codon from 3' end. In wild type it codes for histidine while in mutant it codes…
Q: Given the partial transposons DNA sequence 5’-ACCGTATTCGGT-3’ upstream from the central region,…
A: Transposons are the regions in the DNA molecule that can change their position within the genome.…
Q: Consider the mRNA sequence below. Assume that the following MRNA segment has been translated.…
A: Genetics is the branch of biology that deals with the study of genes, their variation, and heredity…
Q: Consider the mRNA sequence below. Assume that the following mRNA segment has been translated.…
A: The genetic code is a set of three-letter combinations of nucleotides called codons, each of which…
Q: Human wildtype and mutant alleles are identical in sequence except for a single base-pair…
A: A mutation is any change in the DNA sequence of a cell. It may alter one or a few base pairs or…
Q: Let's Apply In each of the following DNA sequences, write on your answer sheet the corresponding…
A: DNA ( Deoxyribonucleic acid ) is two stranded helical structure which act as genetic material in…
Q: A protein has the following amino acid sequence:…
A: The process of translation requires transfer of genetic information from a polymer of nucleotides to…
Q: These are portions of the coding strands of DNA for Wild-Type Hemoglobin and the mutated hemoglobin…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: The following amino acid sequence is found in a tripeptide: Met-TrpHis. Give all possible nucleotide…
A: each amino acid has a specific set of codons for their coding on the mRNA. the mRNA is the exact…
Q: If tRNALeu is mutated so that it is recognized by the tRNAVal synthetase but not the by tRNALeu…
A: Introduction Translation is the process by which ribosomes in the cytoplasm or endoplasmic…
Q: A protein has the following amino acid sequence:…
A: Given: In the given question stem, sequence of amino acid is given and we have to make set of probes…
Q: Based on the N-terminal amino acid sequence, what is the approximate half-life of the protein after…
A: Introduction- N-terminal methionine cleavage plays an important role in protein synthesis in…
Q: The DNA sequence of a short gene from a sea slug, and the mature RNA synthesized from this gene, are…
A: A genetic code is a table consisting of 64 codons each of which code for specific amino acids. These…
Q: - Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic…
A: mRNA contains coding regions (exons) and non-coding regions (introns). The introns are removed by…
Q: Select all of the factors in the list below that play a role in the translation initiation of…
A: Translation : It is the process in which ribosomes in the cytoplasm or endoplasmic reticulum…
Q: If mature eukaryotic MRNA is hybridized with its corresponding genomic DNA template strand and…
A: DNA is the genetic material and is present in the nucleus of the eukaryotic cells.
Q: Instead, the protein produced is nonfunctional and is found to contain many fewer amino acids than…
A: Genetic code is defined as the set of nucleotides which determine the sequence of DNA of a given…
Q: Which DNA strand is identical to the mRNA transcript? Which DNA strand codes the RNA transcript?
A: DNA contains the instructions for protein synthesis. Proteins in turn determine structure and…
Q: Please solve and answer in complete sentences. (thank you) Sequence divergence vs conservation for…
A: The exons are the type of sequences that are utilized after the processing of the mRNA is complete.…
Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…
A: Question - An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal…
Q: A single base addition and a single base deletion approximately 15 bases apart in the mRNA…
A: A codon is represented by group of three nucleotide sequence of DNA or RNA belonging to a single…
Q: Based on this alignment, you can identify areas of the protein sequences that are key regions of the…
A: Multiple sequence alignment is used to obtain optimal matching between three or more sequences of…
Q: For a DNA template strand containing the sequence 3'AATTGGCC 5', what is the sequence of nucleotides…
A: Transcription is the DNA dependent RNA synthetic process. RNA polymerase help in the transcription.…
Q: In studies of the amino acid sequence of wild-type and mutant forms of tryptophan synthetase in E.…
A: The nitrogenous bases that form the mRNA chain are Adenine (A), Guanine (G), Cytosine (C), and…
Q: A protein has the following amino acid sequence:…
A: Amino acids- Amino acids are organic compounds that combine to form proteins. Amino acids and…
Q: The amino acid sequences of peptide fragments obtained from a normal protein were compared with…
A: DNA is not directly involved in the expression of traits thus it acts as a master copy of genetic…
Q: The genetic code was solved partly by the use of in vitro systems to translate synthetic RNAs into…
A: According to the genetic code, a set of three nucleotides, that isis the triplet code for a…
Q: Consider the mRNA sequence below. Assume that the following mRNA segment has been translated.…
A: Translation is the process of synthesis of proteins from mRNA. During the process of translation,…
A Sanger product of the sequencing of a template DNA is presented below. It is the polymorphic peptide sequence of Protein Ser-Gly-Lys-Glu-Gly-Lys-Lys. Determine the sequence of template DNA and the mRNA sequence from this template DNA. Briefly explain.
Step by step
Solved in 4 steps
- Identify the base shown below. Drag the correct base to the rectangle in the image O I HN H₂N Adenine Cytosine N N IZ 5 methyl cytosine H Guanine ThymineGiven the structures of the ribonucleotides and deoxyribonucleotides: Adenine Uracil Thymine HN Adenine NH HO-P-0- CH2 HO-P-0 CH2 HO-P-0-CH2 HO-P-0-CH он он он он OH H OH H Cytosine Cytosine Guanine Guanine NH2 NH NH2 CH2 HOo CH2 HO-P-0 -CH2 он он он он OH H OH H • Draw the structure of the polyribonucleotide UAGCCUG. Draw the structure of the polydeoxyribonucleotide CGTAGAT.Identify the type of base and sugar group present in each nucleotide or nucleoside. HO. H3C. CH₂ OH -²03POCH2 OH 'N N ΝΗ NH₂ Molecule 1 O pyrimidine, deoxyribose O pyrimidine, ribose purine, ribose O purine, deoxyribose Molecule 2 pyrimidine, ribose O pyrimidine, deoxyribose purine, ribose O purine, deoxyribose
- Modify methionine to show its zwitterion form. Select Draw с N 0 Templates S H More 1C || H0 C 1 с | CH₂ | CH₂ | S 1 CH3 HIN I N-H Erase Q 2 QMatch the following terms with their correct definition. The structure of double-standed DNA Hold the base pairs together and make up the rungs of the DNA double helix One strand of nucleotides running in the opposite direction of the other strand Consists of a phosphate, a sugar backbone, and a nitrogen base A-T and C-G base pairs Five-carbon sugar found in DNA Complementary base pairs Double helix Antiparallel Nucleotide Hydrogen bonds Deoxyribose sugarChymotrypsin digestion, separation of peptides, and Edmann technique give the sequences for peptide fragments as follows: C-1 G-A-E-A-T-E C-2 G-K-V-G-A-H-A-G-E-Y C-3 V-L-S-P-A-K-T-N-V-K-A-A-W What is the sequence for the peptide? NOTE: Label the fragments when reconstructing the peptide chain e.g. for trypsin T-1, T-2 etc...
- Identify the correct name or abbreviation for the given nucleoside or nucleotide. guanosine ADP dADP dGDP GDP Identify the correct name or abbreviation for the given nucleoside or nucleotide. GDP dADP ADP O deoxyadenosine dGDP OMP O || -O-P-O-P-O. fot O™ tt -O-P-O- O™ ܘ ܐ ܘ ܐ OIPIO N OH OH OH N H₂N N ΝΗ N NH₂ture.com/courses/7611/assignments/170598?module_itemid%3D695428 TR E Edulastic: Formativ. A Desmos | Testing O YouTube I Quiz | ReadTheory Quill.org - In О в, С, А, D D, B, A, C C, B, D, A How many nucleotides are represented in the diagram? * 2 points O 6 12 18no explanation necessary! Letter of answer only. Part I: Multiple choice 1. The DNA base pairing rules are: a) Any combination of the bases. b) T pairs with C, and A pairs with G. c) A pairs with T, and C pairs with G. d) C pairs with A, and T pairs with G. 2. DNA in cells is damaged: a) Millions of times a day. b) By collisions with other molecules or by chemical accidents and radiation. c) Not very often¸ and by radiation only. d) a and b 3. For genes that code for proteins, which molecule conveys the information from the gene to the ribosome? a) DNA b) mRNA c) tRNA d) rRNA 4. Which of the molecules below is produced during replication? a) mRNA b) rRNA c) tRNA d) DNA 5. Why is there a difference between the synthesis of a lead strand and that of a discontinuous strand in DNA molecules? a) The origins of replication are found only at end 5' of the molecule. b) Helicase and protein factors act at the extremity of 5'. c) DNA polymerases can only add new nucleotides at the extremity 3' a…
- Confirm Regularly bring your favourites, password... of 45 OCR 2021. You may photocopy this page. 7 of 46 Create 4 Which of the following nucleotides contains uracil? A B NH H,C. ofo HN HO-P-O- HO-P-O- OH ОН ОН OH 'NH HO-P- NH, HO-P-O OH ОН ОН OH Your answer An anticodon seguence of five successsive tRNA molecules involved in protein sunthosie was arTranslate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3 O met-ala-phe-lys-stop O met-ala-phe-lys- met-tyr-his-gly-val-stop-met-gly O met-ala-ser-gly-thr-stop O tyr-his gly-val-stop-met-ly O ala-phe-lys stopAU Py U AGGC C UGGC G GG C Jc What modified nucleoside base is indicated by the arrow? dihydrouracil pseudouracil -ACC.