Replicate the DNA strand AAGGCTAACGGCATTTAACCC. Transcribe the DNA strand AAGGCTAACGGCATTTAACCC. Translate your answer to #16 using the table below.

Q: Second Base Analyze the following DNA sequences: A UUU UCU UAU UGU Phe Tyr UUC UCC UAC UGC Original:…

A: So, the given information is:- ORIGINAL- AGAGAGAGAGAGAGAGAG…

Q: digest suspect B's DNA using restriction enzyme 1. Restriction enzyme 1 cleaves the recognition site…

A: The restriction enzymes are endonucleases that digest DNA (deoxyribonucleic acid) molecules by…

Q: Explain the following terms: Non-histone Chromosomal (NHC) proteins, euchromatin &…

A: Chromatin is a complex of DNA and protein found in eukaryotic cells. The primary function of…

Q: What dna polymerase is used for Sanger sequencing

A: Sanger sequencing, also known as dideoxy sequencing, is a widely used method for determining the…

Q: Select all features that are part of Okazaki fragments.   They are checked for accuracy by DNA…

A: The ability to synthesize both of the daughter strands necessary for cell division makes Okazaki…

Q: Check the new protein created by your new DNA. Describe how this changed the protein (amino acid…

A: Deoxyribonucleic acid is a molecule made out of two polynucleotide chains that curl around one…

Q: 1 tctagagtca tgaaacaaca aaaacggctt tacgcccgat tgctgacgct gttatttgcg 61 ctcatcttct tgctgcctca…

A: Forward Primer:5'-TCTAGAGTCAATGAAACAACA-3'Explanation:This sequence starts with the same…

Q: CT/TGT/AAG/ACC/TTT What would be the amino acid sequence created from this mutated DNA strand?

A: The central dogma theory in genetics is based on the processes of Replication, Transcription and…

Q: 5. Patients with palmoplantar keratoderma (PPK) have yellowish thickening of the skin on their hands…

A: Introduction :- A pedigree is a genetic representation of the inheritance of a trait or disease…

Q: A researcher wants to cut this piece of linear DNA. 5 AGCTAGTCCGGATCCGAGGGCCCTTCTCATGAGATCCGGATGACC…

A: The discovery of restriction enzymes in 1968 by Swiss scientist "Werner Arber" ushered in the era of…

Q: Chironomus genomic DNA contains approximately 35.5% A. Estimate the percentages of G, C, and T in…

A: The double (ds) stranded DNA duplex structure follows the chargaffs rule, which suggests that the A…

Q: Use the gel to answer the following questions. You will be constructing a map of the plasmid,…

A: Plasmids have been used in genetic engineering for cloning and expression. These carry the genes for…

Q: Below question 15 is the original DNA molecule. Delete (remove) the underlined letter. 14. What term…

A: DNA stands for deocyribonucleic acid. It is negatively charged molecule residing in the nucleus. It…

Q: Identify the solution component that contains the extracted DNA.

A: Ethanol precipitation method is generally used for DNA extraction.

Q: following question is related to Restriction Enzymes and RFLP. Using EcoRl, which DNA sequence held…

A: Restriction enzymes, also known as restriction endonucleases, are a key tool in molecular biology.…

Q: What is the translated sequence

A: Given the DNA  sequence,  and we have to translate it into amino acid sequence .

Q: Transcribe and translate the DNA strand below. Remember to use the start and stop sequences.…

A: DNA is converted into mRNA, which contains the instructions needed to make proteins through the…

Q: Examine the sequence for the DNA fragment below. Your job is to design primers for PCR that would be…

A: A primer may be a brief single-stranded nucleic acid utilized by all living living beings within the…

Q: How would you write out the sequence for the REVERSE primer if you needed to purchase it for use in…

A: The reason we write the reverse primer sequence in the reverse complement form is to ensure that it…

Q: Read the images given before answering the question below. Identify the two common diseases that…

A: When any change occurs in the order of DNA sequence naturally or synthetically it is called…

Q: Check the new protein created by your new DNA. Describe how this changed the protein (amino acid…

A: Any change in the DNA is called mutation. Some Mutations are beneficial because they add on the…

Q: How would you solve this and how would it look? i am confused

A: The objective of this question is to estimate the size of an unknown DNA fragment using a standard…

Q: Summary table of data for one yeast DNA microarray. Shows 14 of the 6,200 genes on the full…

A: A DNA microarray also known as a DNA chip or gene chip is a high throughput technology used to study…

Q: The diagram (below) shows the completed gel of a Sanger sequencing reaction. The arrows at the…

A: gel electrophoresis is a process in which the negatively charged DNA molecule is separated according…

Q: The following question is related to Restriction Enzymes and RFLP. Using EcoRl, how many fragments…

A: Restriction enzymes are enzymes that cleave DNA. Each enzyme identifies and chops DNA at or near one…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.