Homework Help is Here – Start Your Trial Now!
Science
Biology
re 52 codons but only 51 amino acids in this protein. Why? (please refer to the attachment - the one in the circle are the abbreviations of the amino acids that they represent) "the part one o

re 52 codons but only 51 amino acids in this protein. Why? (please refer to the attachment - the one in the circle are the abbreviations of the amino acids that they represent) "the part one o

Human Anatomy & Physiology (11th Edition)
Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:Elaine N. Marieb, Katja N. Hoehn
Chapter1: The Human Body: An Orientation
Section: Chapter Questions
Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...
See similar textbooks
icon
Related questions
icon
Concept explainers
Question
100%

There are 52 codons but only 51 amino acids in this protein. Why?

(please refer to the attachment - the one in the circle are the abbreviations of the amino acids that they represent)

"the part one of the activity will also be attached"

AutoSave ● ff BUILD A PROTEIN LAB ACTIVITY • Saved to this PC - O Search (Alt+Q) A Tanya Abigail Clemen TA File Home Insert Draw Design Layout References Mailings Review View Help O Comments v A Share X Cut - A A Aa v A aba A O Find v Times New Romar v 12 LE Copy S Replace Paste Dictate Editor Reuse B IU v ab x, x A vev A Select v S Format Painter Files Clipboard Font Paragraph Styles Editing Voice Editor Reuse Files L 1 ... . 1 4 5 . . .| . . . 6 8. I .. As you now know, a gene is a sequence of nucleotides in a DNA molecule that directs the formation of a protein. In the activity below, you will find the gene that codes for the protein known as beef Insulin, which is a protein that breaks down sugar in a cow's blood. Begin by transcribing the gene into mRNA. Then use the mRNA sequence and the codon table to translate the gene into a protein. Use the three letter abbreviations contained in the table to fill in the beef insulin molecule. TACCAGTTAGTCGTAGACACCCTCAGTGGATCACCTCCGGGATATAAACCAAACGCCGCT AUGGUCAAUCAGCAUCUGUGGGAGUCACCUAGUGGAGGCCCUAUAUUUGGUUUGCGGCGA СтстСССААGAAAATGATGGGGTTTCGTCСАТAАСАССТтGTCACAACAGCAAGACAAAС GAGAGGGUUCUUUUACUACCCCAAAGCAGGUAUUGUGGAACAGUGUUGUCGUUCUGUUUG АAGCAACATGGTTAACCTCТTААТААСGAТСТААТТ UUCGUUGUACCAAUUGGAGAAUUAUUGCUAGAUUAA "BUILD A PROTEIN LAB ACTIVITY": 835 characters (an approximate value). O Focus 100% 3:09 PM O Type here to search 日 w 25°C Rain 3/8/2022
Transcribed Image Text:AutoSave ● ff BUILD A PROTEIN LAB ACTIVITY • Saved to this PC - O Search (Alt+Q) A Tanya Abigail Clemen TA File Home Insert Draw Design Layout References Mailings Review View Help O Comments v A Share X Cut - A A Aa v A aba A O Find v Times New Romar v 12 LE Copy S Replace Paste Dictate Editor Reuse B IU v ab x, x A vev A Select v S Format Painter Files Clipboard Font Paragraph Styles Editing Voice Editor Reuse Files L 1 ... . 1 4 5 . . .| . . . 6 8. I .. As you now know, a gene is a sequence of nucleotides in a DNA molecule that directs the formation of a protein. In the activity below, you will find the gene that codes for the protein known as beef Insulin, which is a protein that breaks down sugar in a cow's blood. Begin by transcribing the gene into mRNA. Then use the mRNA sequence and the codon table to translate the gene into a protein. Use the three letter abbreviations contained in the table to fill in the beef insulin molecule. TACCAGTTAGTCGTAGACACCCTCAGTGGATCACCTCCGGGATATAAACCAAACGCCGCT AUGGUCAAUCAGCAUCUGUGGGAGUCACCUAGUGGAGGCCCUAUAUUUGGUUUGCGGCGA СтстСССААGAAAATGATGGGGTTTCGTCСАТAАСАССТтGTCACAACAGCAAGACAAAС GAGAGGGUUCUUUUACUACCCCAAAGCAGGUAUUGUGGAACAGUGUUGUCGUUCUGUUUG АAGCAACATGGTTAACCTCТTААТААСGAТСТААТТ UUCGUUGUACCAAUUGGAGAAUUAUUGCUAGAUUAA "BUILD A PROTEIN LAB ACTIVITY": 835 characters (an approximate value). O Focus 100% 3:09 PM O Type here to search 日 w 25°C Rain 3/8/2022
AutoSave ● ff BUILD A PROTEIN LAB ACTIVITY • Saved to this PC - O Search (Alt+Q) A Tanya Abigail Clemen TA File Home Insert Draw Design Layout References Mailings Review View Help O Comments v A Share X Cut - A A Aa v A aba A O Find v Times New Romar v 12 LE Copy S Replace Paste Dictate Editor Reuse B IU v ab x, x A vev A Select v S Format Painter Files Clipboard Font Paragraph Styles Editing Voice Editor Reuse Files L 1 ... . 1 4 5 . . .| . . . 6 8. I .. As you now know, a gene is a sequence of nucleotides in a DNA molecule that directs the formation of a protein. In the activity below, you will find the gene that codes for the protein known as beef Insulin, which is a protein that breaks down sugar in a cow's blood. Begin by transcribing the gene into mRNA. Then use the mRNA sequence and the codon table to translate the gene into a protein. Use the three letter abbreviations contained in the table to fill in the beef insulin molecule. TACCAGTTAGTCGTAGACACCCTCAGTGGATCACCTCCGGGATATAAACCAAACGCCGCT AUGGUCAAUCAGCAUCUGUGGGAGUCACCUAGUGGAGGCCCUAUAUUUGGUUUGCGGCGA СтстСССААGAAAATGATGGGGTTTCGTCСАТAАСАССТтGTCACAACAGCAAGACAAAС GAGAGGGUUCUUUUACUACCCCAAAGCAGGUAUUGUGGAACAGUGUUGUCGUUCUGUUUG АAGCAACATGGTTAACCTCТTААТААСGAТСТААТТ UUCGUUGUACCAAUUGGAGAAUUAUUGCUAGAUUAA "BUILD A PROTEIN LAB ACTIVITY": 835 characters (an approximate value). O Focus 100% 3:09 PM O Type here to search 日 w 25°C Rain 3/8/2022
Transcribed Image Text:AutoSave ● ff BUILD A PROTEIN LAB ACTIVITY • Saved to this PC - O Search (Alt+Q) A Tanya Abigail Clemen TA File Home Insert Draw Design Layout References Mailings Review View Help O Comments v A Share X Cut - A A Aa v A aba A O Find v Times New Romar v 12 LE Copy S Replace Paste Dictate Editor Reuse B IU v ab x, x A vev A Select v S Format Painter Files Clipboard Font Paragraph Styles Editing Voice Editor Reuse Files L 1 ... . 1 4 5 . . .| . . . 6 8. I .. As you now know, a gene is a sequence of nucleotides in a DNA molecule that directs the formation of a protein. In the activity below, you will find the gene that codes for the protein known as beef Insulin, which is a protein that breaks down sugar in a cow's blood. Begin by transcribing the gene into mRNA. Then use the mRNA sequence and the codon table to translate the gene into a protein. Use the three letter abbreviations contained in the table to fill in the beef insulin molecule. TACCAGTTAGTCGTAGACACCCTCAGTGGATCACCTCCGGGATATAAACCAAACGCCGCT AUGGUCAAUCAGCAUCUGUGGGAGUCACCUAGUGGAGGCCCUAUAUUUGGUUUGCGGCGA СтстСССААGAAAATGATGGGGTTTCGTCСАТAАСАССТтGTCACAACAGCAAGACAAAС GAGAGGGUUCUUUUACUACCCCAAAGCAGGUAUUGUGGAACAGUGUUGUCGUUCUGUUUG АAGCAACATGGTTAACCTCТTААТААСGAТСТААТТ UUCGUUGUACCAAUUGGAGAAUUAUUGCUAGAUUAA "BUILD A PROTEIN LAB ACTIVITY": 835 characters (an approximate value). O Focus 100% 3:09 PM O Type here to search 日 w 25°C Rain 3/8/2022
Expert Solution
trending now

Trending now

This is a popular solution!

steps

Step by step

Solved in 2 steps

SEE SOLUTIONCheck out a sample Q&A here
Blurred answer
Knowledge Booster
Proteins
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:
9780134580999
Author:
Elaine N. Marieb, Katja N. Hoehn
Publisher:
PEARSON
Biology 2e
Biology 2e
Biology
ISBN:
9781947172517
Author:
Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:
OpenStax
Anatomy & Physiology
Anatomy & Physiology
Biology
ISBN:
9781259398629
Author:
McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:
Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:
9780815344322
Author:
Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:
W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:
9781260159363
Author:
Martin, Terry R., Prentice-craver, Cynthia
Publisher:
McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Inquiry Into Life (16th Edition)
Biology
ISBN:
9781260231700
Author:
Sylvia S. Mader, Michael Windelspecht
Publisher:
McGraw Hill Education
SEE MORE TEXTBOOKS