Homework Help is Here – Start Your Trial Now!
Science
Biology
re 52 codons but only 51 amino acids in this protein. Why? (please refer to the attachment - the one in the circle are the abbreviations of the amino acids that they represent) "the part one o

re 52 codons but only 51 amino acids in this protein. Why? (please refer to the attachment - the one in the circle are the abbreviations of the amino acids that they represent) "the part one o

Human Anatomy & Physiology (11th Edition)
Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:Elaine N. Marieb, Katja N. Hoehn
Chapter1: The Human Body: An Orientation
Section: Chapter Questions
Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...
See similar textbooks
icon
Related questions
icon
Concept explainers
Question
100%

There are 52 codons but only 51 amino acids in this protein. Why?

(please refer to the attachment - the one in the circle are the abbreviations of the amino acids that they represent)

"the part one of the activity will also be attached"

AutoSave ● ff BUILD A PROTEIN LAB ACTIVITY • Saved to this PC - O Search (Alt+Q) A Tanya Abigail Clemen TA File Home Insert Draw Design Layout References Mailings Review View Help O Comments v A Share X Cut - A A Aa v A aba A O Find v Times New Romar v 12 LE Copy S Replace Paste Dictate Editor Reuse B IU v ab x, x A vev A Select v S Format Painter Files Clipboard Font Paragraph Styles Editing Voice Editor Reuse Files L 1 ... . 1 4 5 . . .| . . . 6 8. I .. As you now know, a gene is a sequence of nucleotides in a DNA molecule that directs the formation of a protein. In the activity below, you will find the gene that codes for the protein known as beef Insulin, which is a protein that breaks down sugar in a cow's blood. Begin by transcribing the gene into mRNA. Then use the mRNA sequence and the codon table to translate the gene into a protein. Use the three letter abbreviations contained in the table to fill in the beef insulin molecule. TACCAGTTAGTCGTAGACACCCTCAGTGGATCACCTCCGGGATATAAACCAAACGCCGCT AUGGUCAAUCAGCAUCUGUGGGAGUCACCUAGUGGAGGCCCUAUAUUUGGUUUGCGGCGA СтстСССААGAAAATGATGGGGTTTCGTCСАТAАСАССТтGTCACAACAGCAAGACAAAС GAGAGGGUUCUUUUACUACCCCAAAGCAGGUAUUGUGGAACAGUGUUGUCGUUCUGUUUG АAGCAACATGGTTAACCTCТTААТААСGAТСТААТТ UUCGUUGUACCAAUUGGAGAAUUAUUGCUAGAUUAA "BUILD A PROTEIN LAB ACTIVITY": 835 characters (an approximate value). O Focus 100% 3:09 PM O Type here to search 日 w 25°C Rain 3/8/2022
Transcribed Image Text:AutoSave ● ff BUILD A PROTEIN LAB ACTIVITY • Saved to this PC - O Search (Alt+Q) A Tanya Abigail Clemen TA File Home Insert Draw Design Layout References Mailings Review View Help O Comments v A Share X Cut - A A Aa v A aba A O Find v Times New Romar v 12 LE Copy S Replace Paste Dictate Editor Reuse B IU v ab x, x A vev A Select v S Format Painter Files Clipboard Font Paragraph Styles Editing Voice Editor Reuse Files L 1 ... . 1 4 5 . . .| . . . 6 8. I .. As you now know, a gene is a sequence of nucleotides in a DNA molecule that directs the formation of a protein. In the activity below, you will find the gene that codes for the protein known as beef Insulin, which is a protein that breaks down sugar in a cow's blood. Begin by transcribing the gene into mRNA. Then use the mRNA sequence and the codon table to translate the gene into a protein. Use the three letter abbreviations contained in the table to fill in the beef insulin molecule. TACCAGTTAGTCGTAGACACCCTCAGTGGATCACCTCCGGGATATAAACCAAACGCCGCT AUGGUCAAUCAGCAUCUGUGGGAGUCACCUAGUGGAGGCCCUAUAUUUGGUUUGCGGCGA СтстСССААGAAAATGATGGGGTTTCGTCСАТAАСАССТтGTCACAACAGCAAGACAAAС GAGAGGGUUCUUUUACUACCCCAAAGCAGGUAUUGUGGAACAGUGUUGUCGUUCUGUUUG АAGCAACATGGTTAACCTCТTААТААСGAТСТААТТ UUCGUUGUACCAAUUGGAGAAUUAUUGCUAGAUUAA "BUILD A PROTEIN LAB ACTIVITY": 835 characters (an approximate value). O Focus 100% 3:09 PM O Type here to search 日 w 25°C Rain 3/8/2022
AutoSave ● ff BUILD A PROTEIN LAB ACTIVITY • Saved to this PC - O Search (Alt+Q) A Tanya Abigail Clemen TA File Home Insert Draw Design Layout References Mailings Review View Help O Comments v A Share X Cut - A A Aa v A aba A O Find v Times New Romar v 12 LE Copy S Replace Paste Dictate Editor Reuse B IU v ab x, x A vev A Select v S Format Painter Files Clipboard Font Paragraph Styles Editing Voice Editor Reuse Files L 1 ... . 1 4 5 . . .| . . . 6 8. I .. As you now know, a gene is a sequence of nucleotides in a DNA molecule that directs the formation of a protein. In the activity below, you will find the gene that codes for the protein known as beef Insulin, which is a protein that breaks down sugar in a cow's blood. Begin by transcribing the gene into mRNA. Then use the mRNA sequence and the codon table to translate the gene into a protein. Use the three letter abbreviations contained in the table to fill in the beef insulin molecule. TACCAGTTAGTCGTAGACACCCTCAGTGGATCACCTCCGGGATATAAACCAAACGCCGCT AUGGUCAAUCAGCAUCUGUGGGAGUCACCUAGUGGAGGCCCUAUAUUUGGUUUGCGGCGA СтстСССААGAAAATGATGGGGTTTCGTCСАТAАСАССТтGTCACAACAGCAAGACAAAС GAGAGGGUUCUUUUACUACCCCAAAGCAGGUAUUGUGGAACAGUGUUGUCGUUCUGUUUG АAGCAACATGGTTAACCTCТTААТААСGAТСТААТТ UUCGUUGUACCAAUUGGAGAAUUAUUGCUAGAUUAA "BUILD A PROTEIN LAB ACTIVITY": 835 characters (an approximate value). O Focus 100% 3:09 PM O Type here to search 日 w 25°C Rain 3/8/2022
Transcribed Image Text:AutoSave ● ff BUILD A PROTEIN LAB ACTIVITY • Saved to this PC - O Search (Alt+Q) A Tanya Abigail Clemen TA File Home Insert Draw Design Layout References Mailings Review View Help O Comments v A Share X Cut - A A Aa v A aba A O Find v Times New Romar v 12 LE Copy S Replace Paste Dictate Editor Reuse B IU v ab x, x A vev A Select v S Format Painter Files Clipboard Font Paragraph Styles Editing Voice Editor Reuse Files L 1 ... . 1 4 5 . . .| . . . 6 8. I .. As you now know, a gene is a sequence of nucleotides in a DNA molecule that directs the formation of a protein. In the activity below, you will find the gene that codes for the protein known as beef Insulin, which is a protein that breaks down sugar in a cow's blood. Begin by transcribing the gene into mRNA. Then use the mRNA sequence and the codon table to translate the gene into a protein. Use the three letter abbreviations contained in the table to fill in the beef insulin molecule. TACCAGTTAGTCGTAGACACCCTCAGTGGATCACCTCCGGGATATAAACCAAACGCCGCT AUGGUCAAUCAGCAUCUGUGGGAGUCACCUAGUGGAGGCCCUAUAUUUGGUUUGCGGCGA СтстСССААGAAAATGATGGGGTTTCGTCСАТAАСАССТтGTCACAACAGCAAGACAAAС GAGAGGGUUCUUUUACUACCCCAAAGCAGGUAUUGUGGAACAGUGUUGUCGUUCUGUUUG АAGCAACATGGTTAACCTCТTААТААСGAТСТААТТ UUCGUUGUACCAAUUGGAGAAUUAUUGCUAGAUUAA "BUILD A PROTEIN LAB ACTIVITY": 835 characters (an approximate value). O Focus 100% 3:09 PM O Type here to search 日 w 25°C Rain 3/8/2022
Expert Solution
trending now

Trending now

This is a popular solution!

steps

Step by step

Solved in 2 steps

SEE SOLUTIONCheck out a sample Q&A here
Blurred answer
Knowledge Booster
Proteins
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
  • SEE MORE QUESTIONS
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:
9780134580999
Author:
Elaine N. Marieb, Katja N. Hoehn
Publisher:
PEARSON
Biology 2e
Biology 2e
Biology
ISBN:
9781947172517
Author:
Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:
OpenStax
Anatomy & Physiology
Anatomy & Physiology
Biology
ISBN:
9781259398629
Author:
McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:
Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:
9780815344322
Author:
Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:
W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:
9781260159363
Author:
Martin, Terry R., Prentice-craver, Cynthia
Publisher:
McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Inquiry Into Life (16th Edition)
Biology
ISBN:
9781260231700
Author:
Sylvia S. Mader, Michael Windelspecht
Publisher:
McGraw Hill Education
SEE MORE TEXTBOOKS