QUESTION 5For each of the following epigenetic modifications, describle how it affects transcription using the answers below:a Increases trasnscriptionb. Decreases transcriptionc. Can increase or decrease transcription depending on which amino acid/nucleotide is being modified.Histone acetylationHistone methylationDNA methylation富

Histone Acetylation:Effect on Transcription: Increases transcriptionMechanism: Histone acetylation…

Answered: QUESTION 5 For each of the following…

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter16: Gene Expression

Section: Chapter Questions

Problem 39CTQ: New drugs are being developed that decrease DNA methylation and prevent the removal of acetyl groups...

See similar textbooks

Similar questions

please help with question 1 and 2.
Question 4 The stages of transcription includes the followings except RNA processing O initiation O elongation O termination
31 Changes in function of which of the following protein by posttranslational modification (such as phosphorylation or acetylation) would be most likely to, in turn, affect the expression of specific genes? Question 31 options: TFIID Histone TATA-binding protein AP-1 complex Previous PageNext Page
Any mutation inside or outside a coding regionthat reduces or abolishes protein activity in one of the manyways previously described is a loss-of-function _______?
Question 6. What are the first three amino acids in the protein that is produced from this gene? Write the amino acids using the three-letter code separated by a hyphen. -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAG GCTATATT CA CGTGGATGGTCAGTA... 3' 3' CTAAGGCATAATGTCGTATCCGATATAAGTG CACCTACCGATCAT... 5' Start site
Question 10. Where do regulatory transcription factors bind relative to a gene sequence?
The tumor suppressor pRB also binds to and suppresses theactivity of retinoblastoma binding protein 2 (RBP2), ahistone demethylase that removes methyl groups from diand trimethylated lysines in histone 3. What is the possibleconsequence of an inactivating mutation in RB1 that causesan inability of pRB to bind RBP2?
Please answer asap
Question 7. What is the sequence of the primary transcript produced from this gene? -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAGGCTATATTCACGTGGTACGCTA 3' 3' CTAAGGCATAATGTCGTATCCGATATAAGTGCACCATGCGAT 5' Start site
please answer part 5
Answer parts a and b pictured in the image
Need help for both question

SEE MORE QUESTIONS

Recommended textbooks for you

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

SEE MORE TEXTBOOKS