A spherical cell with the diameter of 10uMhas a protein concentration of 20 mg/ml. Determine the number of protein molecules within the cell if the molecular weight of an average protein is 50,000 daltons (g/mol). Recall that Avogadro's number is NA 6.0221367×1023 molecules/mol. =
Q: What are our conscious and inadvertent effects on evolution and biodiversity?
A: Intentioned and inadvertently changing biodiversity and evolutionary shapes, human action contains a…
Q: Before you can start your clinical rotation, you are required to get a tuberculosis (TB) test. The…
A: This is an example of a delayed-type hypersensitivity (DTH) reaction.Here's a breakdown of…
Q: DNA: Using the two deoxynucleotides you chose, draw the two monomers bound together into a compound,…
A:
Q: A graduate student was assaying LD50 (lethal dose 50%) of two temperature-sensitive Francisella…
A: Given:At 20°C: Strain A LD50 = 100, Strain B LD50 = 1000. At 37°C: Strain A LD50 = 1000, Strain B…
Q: What is suspected when the hematocrit has decreased by 4% and the total bilirubin level is increased…
A: The objective of the question is to identify the possible medical condition based on the given…
Q: Types of lipids
A: 1. Triglycerides: - Composed of glycerol and three fatty acid chains - Major form of stored energy…
Q: What scenario could lead to the founder effect in a population? Natural selection acting on genetic…
A: The objective of the question is to identify which scenario could lead to the founder effect in a…
Q: Which of the following is 100% reabsorbed in healthy people?
A: Process of glucose reabsorption in the kidneys and why it's essential for maintaining glucose…
Q: I have a vial of F2 offspring resulting from a two-generation cross between true-breeding wildtype…
A: b) Pink body color females:Expected number = Total number of flies * Probability of being pink= 120…
Q: If a DNA strand has the sequence AGCATC, what will be the sequence on the complementary strand?
A: Sure, let's break it down step by step:1. The given DNA sequence is AGCATC.2. According to the base…
Q: 17
A: The question is asking about the possible outcomes of alternate splicing of a gene that has 6 exons.…
Q: 1.) why people living in poor neighborhoods have a more difficult time eating well and have higher…
A: Let's break down how the answer comprehensively addresses the question based on the reference,…
Q: Draw a molecule of DNA undergoing theta replication. On your drawing, identify (a) origin of…
A: Deoxyribonucleic acid (DNA) is a double-stranded molecule, which consists of two strands of…
Q: What are the five mass extinctions of the past and the current theory of the sixth mass extinction?…
A: The objective of the question is to understand the five major mass extinctions that have occurred in…
Q: When Mendel crossed yellow-seeded and green-seeded pea plants, all the offspring were yellow-seeded.…
A: The allele for yellow seeds should be written in uppercase letters, while the one for green seeds…
Q: Name Sofia Falcione P Pedigree Analysis Practice - for each pedigree, write the genotypes of the…
A: 1. **Maple Syrup Urine Disease (MSUD)**: - MSUD is inherited in an autosomal recessive manner,…
Q: Which of the following does NOT result from the malignant proliferation of plasma cells?…
A: The question is asking us to identify which of the given options is not a result of the malignant…
Q: Suggest the most appropriate organic/aqueous medium for use in determining P values in the following…
A: Partition coefficients (P values) are vital in understanding how a medication or chemical carries on…
Q: A premature infant typically lacks subcutaneous adipose tis- sue. Also, the surface area of an…
A: A imperative physiological work, thermoregulation, the capacity to regulate body temperature…
Q: which of the following do researchers not need to use during vector cloning? a. a plasmid containing…
A: The objective of the question is to identify the component that is not necessary during the process…
Q: -Centromere D D Ø ☹ A B ℗ ℗ D E C
A: To determine the correct chromosomal condition for one daughter nucleus at telophase of mitosis, we…
Q: What physical appearance (Solid, liquid, semi-solid) of following Media: Broth tube, agar slant…
A: Agar is a polysaccharide composed of agarose and agaropectin. It is a gelatinous substance used in…
Q: (a) 5' 3' GGCGCAGUGGGCUAGCGCCA (b) (((((..AAAAAA. ))))) (၁) AAAGGCCCAU aaaaaa.
A: The H-type pseudoknot is a common RNA structure composed of two helical stems (S1 and S2) and two…
Q: G10
A: The question is asking to determine the number of exons in a gene if it is known that the gene has…
Q: 7. Complete the following diagram which describes a small eukaryotic open reading frame, by filling…
A: Template Strand:The template strand is indeed the DNA strand that serves as a template during…
Q: What type of behavior is Bees attracted to the smell of the flower and flying towards the scent.
A: The behavior of bees being attracted to the smell of a flower and flying towards the scent is an…
Q: consequences of not managing water
A: Key references:…
Q: Why the answer is 0.60. please explain
A: 1. **Graph Interpretation**: - The graph serves as a visual representation of the changes in the…
Q: describe the outcome of EGFR inhibition as well as the differences between erlotinib and…
A: 1. Outcome of EGFR Inhibition:• Cell Growth Inhibition: EGFR is a receptor tyrosine kinase (RTK)…
Q: Name two types of non-infectious hepatitis.
A: Non-infectious hepatitis is a type of liver inflammation that is not caused by viral or bacterial…
Q: Let's suppose that a normal chromosome carries genes labeled A through /. The centromere is located…
A: A. Ignoring fertility issues, the individual with the inverted chromosome will likely be…
Q: What must be present in a population for natural selection to act on? Abundant resources A large…
A: The question is asking about the necessary conditions for natural selection to occur in a…
Q: In what stage of mitosis is the cell labeled "A"? A shutterstock B www.shutterstock.com 159810452 O…
A: During metaphase, which is a crucial stage of mitosis, the cell undergoes several key events as it…
Q: What does it mean that an allele increases an organism's fitness? Choose one of the following: it…
A: Alleles: These are different forms of a gene. Organisms inherit alleles from their parents, and…
Q: Poultry scientists are doing research on the design of diets that are nutritionally complete for…
A: The Specific Dynamic Action (SDA) alludes to the increment in vitality use over the basal metabolic…
Q: B. How long does it take to develop and bring a GMO crop to market? C. What are some of the…
A: Developing and marketing genetically modified organisms (GMOs) for agriculture is a complex process.…
Q: Which Renaissance artist and engineer produced sketches of tanks, submarines, helicopters, machine…
A: The question is asking for the name of the Renaissance artist and engineer who not only produced…
Q: Suppose an efficient conducting system evolved in a moss that could transport water and other…
A: Mosses are the flowerless, non-vascular and small plants that are generally present in shady or damp…
Q: For a virus to transform a cell, which of the following events must occur: Group of answer choices…
A: The objective of the question is to identify the necessary events that must occur for a virus to…
Q: Describe the difference between relative and absolute dating, making sure to give an example of a…
A: The objective of this question is to understand the difference between relative and absolute dating,…
Q: 16) Bacterial DNA replication is said to be: a) Linear b) curvilinear c) circular d) exponential e)…
A: 16) Bacterial DNA replication is said to be circular. This is because bacterial DNA is organized in…
Q: Human Skin Color: Evidence for Selection Name: Jayden Bodisto Make observations of the Figure below.…
A: The objective of the question is to understand the relationship between UV radiation and skin color,…
Q: which of the following do researchers not need to use during vector cloning? a. a plasmid containing…
A: Certainly! Let's delve deeper into each option:a. Plasmid containing selectable marker genes: When…
Q: Starting at rest (on a spaceship), an object falls 1,600 feet towards the Earth (acceleration = 32…
A: The objective of this question is to find out the time it took for an object to fall from a…
Q: Microorganisms that cause disease only when the body is already immunocompromised in some way or…
A: Option a: This option is incorrect because even in people who are feeling well, virulent viruses can…
Q: -What do records for salamander mussels tell us in the absence of records for mudpuppies? -Can we…
A: Salamander mussels (Pleurobema cordatum) and mudpuppies (Necturus maculosus) are two species that…
Q: Name three advantages of seeds over spores in terms of the probability that the next sporophyte…
A: Probability is the term used to portray the probability that some occasion will happen.…
Q: What is the difference between ventilation and respiration?
A: Ventilation:Ventilation is the process of moving air in and out of the lungs. It involves the…
Q: Please answer both thank you!
A: 11)Answer:Centrifuges are workhorses in blood analysis, utilizing the principles of circular motion…
Q: Microarrays a. must be preceded by a sothern blot b. compare gene expression levels across many…
A: Here's why the other options are incorrect:a. must be preceded by a southern blot: Southern blots…
Step by step
Solved in 2 steps
- Aquaporins are proteins embedded in the plasma membrane that allow water molecules to move between the extracellular matrix and the intracellular space. Based on its function and location, describe the key features of the protein’s shape and the chemical characteristics of its amino acids.Using the Nernst equation, calculate the equilibrium potential for Ca2 and for C1 from the following sets of data: a. Given [ Ca2+ ]0=1mM,[ Ca2+ ]i=100nM, find Eca2+ b. Given [ Cl- ]0=110mM,[ Cl- ]i=100mM, find EclTHOUGHT QUESTION Imagine we identify a gene that is directly responsible for the effects of vasopressin on male mammals, including humans-we will call it trust1-that leads to the production of a vasopressin receptor in the brain, which we will call TRUST1. There are different versions of trust1, all of which lead to different levels of the behavior associated with this neuropeptide on male behavior. Give some examples where it would be a good idea to know a particular males genotype-that is, which of the trust1 genes he has. Give an example of when you think science has gone too far and this information should not be known.
- MATHEMATICAL Calculate the isoelectric point of each of the following amino acids: glutamic acid, serine, histidine, lysine, tyro- sine, and arginine.Cholesterol is an integral part of plasma membranes. Based on its structure, where is it found in the membrane? on the extracellular surface embedded with the phospholipid heads within the tail bilayer attached to the intracellular surfaceMATHEMATICAL The buffer needed for Question 35 can also be prepared using crystalline NaH2PO4 and a solution of 1.0 M NaOH. How would you do this?
- Why do ions have a difficult time getting through plasma membranes despite their small size?In each of the three systems, determine the state of entropy (low or high) when comparing the first and second: i. the instant that a perfume bottle is sprayed compared with 30 seconds later, ii. an old 1950s car compared with a brand new car, and iii. a living cell compared with a dead cell. a. i. low, ii. high, iii. low b. i. low, ii. high, iii. high c. i. high, ii. low, iii. high d. i. high, ii. low, iii. lowDescribe the differences in the four protein structures.
- MATHEMATICAL Sketch a titration curve for the amino acid cysteine, and indicate the pKa values for all titratable groups. Also indicate the pH at which this amino acid has no net charge.The pH of lemon juice is 2, and the pH of orange juice is 4. Which of these is more acidic, and by how much? What does this mean?REFLECT AND APPLY Which statements are consistent with the fluid-mosaic model of membranes? (a) All membrane proteins are bound to the interior of the membrane. (b) Both proteins and lipids undergo transverse (flip-flop) diffusion from the inside to the outside of the membrane. (c) Some proteins and lipids undergo lateral diffusion along the inner or outer surface of the membrane. (d) Carbohydrates are covalently bonded to the outside of the membrane. (e) The term mosaic refers to the arrangement of the lipids alone.