QUESTION 37 If glycogen synthase kinase-3 is active (check all that apply): O glycogen will not be made Oglucose will not be made Oglycogen will be made it is in its phosphorylated form Oglycogen synthase is inactive
Q: At room temperature (20 °C), milk turns sour in about 64 hours. In a refrigerator at 3 °C, milk can…
A: A derived form of Arrhenius equation can be used to solved this problem. This equation is given…
Q: If the following oligosaccharide was treated with an enzyme that cleaved only a1,4 glycosidic bonds,…
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: *The following reaction occurs during the glycolysis pathway: glucose-6-phosphate…
A: In a general reaction such as: aA + bB ⇌ cC + dD At equilibrium (steady state), the concentration of…
Q: Elongation of fatty acids chains beyond 16 carbons takes place: on the membrane of the endoplasmic…
A: Acetyl CoA from glucose oxidation or other anaplerotic reactions is produced in mitochondria and…
Q: The specific activity of a pure preparation of pyruvate kinase (PK) assayed in the direction of…
A: Pyruvate kinase (PK): The role of pyruvate kinase is to catalyze the final phase of glycolysis,…
Q: Select ALL statements that are true about the isoelectric point (pI) of a protein a.Protein carries…
A: The isoelectric point (pI) of a protein is the pH at which the protein is neutral or the overall…
Q: For each pair of biomolecules, identify the type of reaction (oxidation‑reduction, hydrolysis,…
A: Enzymes are classified as oxidoreductases, transferases, hydrolases, lyases, isomerases, and ligases…
Q: An unknown sample was tested if there is a presence of lipid, after the test it shows that it is…
A: These are the various preliminary and qualitative tests to estimate the presence and nature of…
Q: Examine the membrane lipid pictured below and answer the following questions: a. Is this lipid…
A: Fatty acids are carboxylic acids with a hydrocarbon chain. Fatty acids may be saturated or…
Q: Why do enzymes contain metals? What general reaction types to metalloenzymes catalyze?
A: Enzymes are biological catalysts proteinateous in nature that catalyze large number of biochemical…
Q: Experiment: DNA Extraction from Banana The procedures are attached below. Questions: 1. What does…
A: DNA extraction is a method to obtain the purified chunk of DNA molecule from the mixture. It can be…
Q: Phosphoenolpyruvate (PEP) is converted to pyruvate by the enzyme pyruvate kinase. The standard free…
A: The standard free energy change (∆Gº') is the amount of energy released in of biochemical reaction…
Q: What is the main advantage of fluorescence polarization? Sensitivity of fluorescent probes Low cost…
A: FP is an analytical technique which provides information on orientation and mobility of…
Q: Electron transport chain. Complex 2
A: Electron transport is a succession of redox reactions, much like a relay race. It is a component of…
Q: 5. Which of the following is true about myoglobin and/or hemoglobin? O (a) The iron in Hb is in the…
A: Both hemoglobin & myoglobin are globular proteins. Our red blood cells (RBCs) are composed of…
Q: Which of the following first messengers is a polypeptide? O acetylcholine adrenaline O insulin…
A: First messengers are biomolecules that bind to the cellular receptor to elicit a response within the…
Q: Imagine that you were asked to denature a protein; you know you can do so using urea. Your protein…
A: Denaturation is the process by which a protein looses it native structure, to the level that protein…
Q: High levels of glucose-6-phosphate inhibit glycolysis. If the concentration of glucose-6-phosphate…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP the energy…
Q: 4. Shown below is the structure of the anti-retroviral drug AZT. 5' HOCH, H 3 N₂ HN AZT H 12 H CH₂…
A: AZT is a drug that is used to treat HIV. HIV is a retro virus that causes the syndrome AIDS. When…
Q: 1. What role do eicosanoids play in the body? What is the primary fatty acid in their composition?…
A: INTRODUCTION : Eicosanoids - They are classified as a group of molecules which are being derived…
Q: Problem. The student conducted a chemical experiment to prove the reducing properties of maltose…
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: 5. Arrange the following fatty acids in order from lowest melting point to highest: myristic acid,…
A: Since you have posted multiple questions, we will provide the solution only to the first question as…
Q: Pathological Constituents of Urine Fill in the table below for your observations Pathological…
A: Since you have posted a question with multiple sub parts, we will provide the solution only to the…
Q: Glycolysis is the process by which energy is harvested from glucose by living things. Several of the…
A: In a general reaction such as: aA + bB ⇌ cC + dD At equilibrium (steady state), the concentration of…
Q: One of your colleagues has obtained a sample of muscle phosphorylase b that is known to be…
A: Glycogen is storage-type homopolysaccharides that contain two types of glucose polymers: amylose:…
Q: Tay-Sachs disease is result from a)malfunction of cerebroside metabolism b)the accumulation of GM2…
A: Tay Sachs disease is a recessively inherited genetic disease. It is characterised by the destruction…
Q: Briefly describe the role of the heat shock protein Hsp70 in protein folding.
A: Heat shock proteins (HSPs), also referred to as stress proteins, are a group of efficient proteins…
Q: 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above…
A: The DNA contain genes (functional unit) that encode protein molecules. Proteins are the "workhorses"…
Q: Next exam will be on carbohydrates, protein equencing and enzymes iochemistry roblem Assignment…
A: Emil Fischer invented the Fischer projection, a method of representing the three-dimensional…
Q: 4. The figure below shows ATP in the binding site of pyruvate kinase, an important enzyme cellular…
A: Pyruvate kinase is the enzyme that catalyses the conversion of phosphoenolpyruvate to pyruvate. It…
Q: true/false: Glutamine synthetase is responsible for the synthesis of glutamine from glutamate.
A: Both glutamate and glutamine are non-essential amino acids. These are glycogenic amino acids.…
Q: A) List each of the five major functional classes of proteins. B) Discuss the function for each…
A: Amino acids are what makeup proteins. Protein structures are biopolymeric. Twenty amino acids are…
Q: In order to break the carbon-carbon bond of Acetyl-CoA in a way that does not harm the cell, citrate…
A: Glycolysis is the metabolic pathway by which 6-carbon glucose is converted into 3-carbon pyruvate in…
Q: Select one: O a. will require an input of energy O b. O c. will absorb energy O d. is not a…
A: The Gibbs–Helmholtz equation is a thermodynamic equation which is used calculating changes in the…
Q: Please answer both of the following 1) The Haworth projection of D-altrose is shown What type of…
A: The cyclic structure of Glucose : The cyclic structure of furanose : The cyclic structure of…
Q: Could you help with part d? Create a speciation diagram for histidine by plotting Xi vs pH from pH =…
A: His is a basic amino acids with pKa value of its side chain ~6, amine and carboxyl groups pKa values…
Q: Given the data in the table below and your knowledge of the "chemical standard state" (X) and the…
A: Chemical standard state is defined by standard conditions in chemical systems. These standard…
Q: Could you please explain in detail why they end up in aspartate? Illustrations with 14C labelled…
A: All the metabolic reactions occurring inside the living system provides energy and replenishes the…
Q: An animal cell is capable of converting alanine into serine. What is the shortest pathway using…
A: Amino acids are classically considered the building blocks for the synthesis of proteins. The unique…
Q: Glucagon is a hormone that indicates low blood glucose. A. Where is glucagon generated and released…
A: Carbohydrates that are obtained through the diet are digested into monosaccharides such as glucose…
Q: For each pair of biomolecules, identify the type of reaction (oxidation‑reduction, hydrolysis,…
A: Enzymes are proteins that act as biocatalysts. Enzymes are classified into six classes based on the…
Q: Which of the following first messengers is hydrophobic and binds to a nuclear receptor protein…
A: The first messengers are extracellular biomolecules that bind to the cellular receptor and elicit a…
Q: What are the qualitative tests to characterize isolated RNA?
A: RNA or ribonucleic acid, most often single stranded nucleic acid found is all living organisms is…
Q: Q1B: Calculate the number of wear particles produced per year, assuming spherical UHMWPE particles…
A: Total hip replacement (THA), commonly known as total hip arthroplasty (THA), is one of the most…
Q: Draw a lipid structure. Properly label the polar and non-polar ends of the representation of a lipid…
A: Lipids are compounds which are soluble in organic solvents and insoluble in polar solvents, i.e.,…
Q: When an enzyme interacts with the substrate, which of the following occurs?
A: Enzymes are high molecular-weight proteins that catalyse biochemical reactions. They are also called…
Q: Which of the following is 18:248,11?
A: Fatty acids can be named and numbered in 2 ways. Fatty acids have a carboxylate end (COO- ) and a…
Q: All enzymes of the citric acid cycle are located in the mitochondrial matrix, except succinate…
A: Cellular respiration is the process how biochemical energy is generated from food. It involves the…
Q: Draw the electron pushing mechanism
A: Electron pushing mechanism shows the jumping of electrons in the substrate and/or reaction…
Q: Do carbohydrates and sugars cause weight gain? Briefly Explain the answer.
A: Carbohydrates are biomolecules that act as the major source of energy. Sugars are carbohydrates with…
Step by step
Solved in 2 steps
- QUESTION 22 All of the following elements are involved in the signaling cascade that promotes glycogen breakdown EXCEPT: O ylic AMP dependent protein kinase A. Adenyl Cyclase Phospholipase C-y. Glycogen Phosphorylase Glycogen Phosphorylase KinaseQuestion 10 Which pathways are stimulated by glucagon? Select all that apply. glycogen metabolism tatty acid synthesis ketogenesis cholesterol synthesis glycogen synthesisQUESTION 34 Adenylyl cyclase activity will increase in response to the binding of adenosine triphosphate protein kinase A phosphorylated CAMP activated Gs protein
- QUESTION 1 There are dozens of different genetic variants of G-alpha. Compared to cells expressing a normal variant, what would expect to see in cells expressing a variant of G-alpha that has bigher than normal GTPase activity? (Select all that apply) O It would increase Protein phosphatase-1 activity It would increase glycogen synthesis It would increase glycogen phosphorytase activity O It would increase glucose production OIt would increase levels of CAMP It would increase Protein kinase A activity QUESTION 2 Protein phosphatase-1 (aka "many proteins phosphatase") acts during G-protein signaling to dephosphorylate and thereby (Select or that apply) D activate enzymes involved in glycogen breakdown. O activate enzymes involved in glycogen synthesis. D inactivate enzymes involved in glycogen breakdown. O inactivate erzymes involved in glycogen synthesisQuestion 52 Accumulation of Citrulline in blood and urine is caused by a deficiency of which of the following? Arginosuccinate synthetase Arginosuccinate lyase Arginase-l O N-acetylglutamate synthaseQuestion 26 Which of the following glycerophospholipid has a phosphate ester attached to a sugar moiety? O Phosphatidylcholine O Phosphatidylglucopyranoside Phosphatidylinositol O Phosphatidylethanolamine
- QUESTION 10 Select a property that does not belong to allosteric enzymes. They conform to hyperbolic Michaelis-Menten kinetics They may have binding sites for regulatory molecules that are separate from active sites They tend to have a signmoidal curve of rate versus [S] They undergo conformation changes as a result of modulator binding.QUESTION 23 With regard to the action of phospholipases C-B and C-y on phosphatidyl inositol, all of the following statements are true EXCEPT: The products of the reaction can stimulate Ca2+ release. The reaction products resulting from phospholipase C activity stimulate adenyl cyclase Phospholipase C-B and C-y are activated by different receptor families which lie upstream of these lipases. The enzymes cut between the diacylglycerol (DAG) and inositol phosphate (IP3) moieties. Phospholipase C-B and C-y are both calcium dependent.Question 13 Which enzyme catalyzes the conversion of Triglycerides to glycerol and fatty acids? O Lipase Peroxidase Glycerol-3-phosphate oxidase Cholesteryl ester hydrolase
- QUESTION 1 You have a crude lysate sample (CL) containing a mixture of six proteins (1, 2, 3, 4, 5, ẞ- galactosidase), and your goal is to obtain purified ẞ-gal. Some characteristics of these proteins are shown in the table below Protein Alcohol dehydrogenase Carbonic anhydrase Insulin B chain Phosphorylase B Glutamic dehydrogenase B-galactosidase Concentration of ammonium sulfate (AS) required for precipitation Molecular Weight (kDa) Isoelectric point (pl) 45% 38 3.7 80% 65% 20% 30% 45% 28 4.8 4 5.3 98 6.8 . 49 9.5 115 5.3 You begin your purification by performing an ammonium sulfate (AS) precipitation. You add the appropriate concentration of AS to your CL sample, incubate overnight at 4°C, then centrifuge to generate a supernatant (AS-S) and pellet (AS-P). What concentration of AS will you use to precipitate ẞ-galactosidase? 20% 30% 45% 65% O 80%Question 9 Match the enzyme with a phrase about it. v Catalyzes a substrate lovei phosphorylation 3. Pyruvate kinaise v breaks down sucrose to glucose and fructose b. phosphovylase e phosphohaxesa semerase (ato called giasose-6 phosphete samerane) v is a type of isomerase v removes one glucose residue from glycogen d. Sucrase A Muving to another question will save this responseQuestion 12 Which enzyme catalyzes the conversion of Cholesteryl ester to cholesterol and fatty acid? O Cholesteryl ester hydrolase Glycerol-3-phosphate oxidase Lipase Peroxidase