Question 17 Match the following Prompts Submitted Answers Eukaryotic rRNA genes are transcribed and processed in the Choose a match Termination of bacterial transcription may require the Choose a match factor. In eukaryotes, RNA polymerase does not include a removable Choose a match factor. Most have well defined 3' ends terminating in poly(A) tails Choose a match of - 250 nt. The nontemplate strand is also known as the strand. Choose a match

Q: Review transcription. Match the term and its description. Each term can only be used once. RNA…

A: RNa synthesis is catalyzed by the enzyme - RNA polymerase The DNA sequence where RNA polymerase…

Q: Please answer fast True or False During transcription in prokaryotes, the initiation of…

A: Transcription is a process in which the double stranded DNA is converted to RNA which is translated…

Q: What if you designed a CRISPR/cas9 assay for a gene knockout, but there's no PAM sequence…

A:

Q: Question 4 About endonucleases: A Restriction endonucleases always cut double-stranded DNA and are…

A: Nuclease is the nucleic acid digesting enzyme. Nuclease is of two types 1. exonuclease…

Q: Affected people are usually born to unaffected parents. Parents of affected people are usually…

A: 1. Autosomal recessive  2  X linked dominant  3. X linked recessive  4.  Y linked

Q: Question 7. What is the sequence of the primary transcript produced from this gene? -35 sequence…

A: A gene is a segment of DNA that contains the necessary information for the synthesis of a functional…

Q: QUESTION 18 Which of the following statements about termination mechanisms for nucleic acid…

A: Transcription termination is the process where a nascent RNA is released from its complex with RNA…

Q: Question 11. During ligation, the plasmid vector is prevented from re-ligating to itself by: a.…

A: Ligation is the process of joining two or more DNA fragments together using a ligase enzyme. In…

Q: Question 4. What is the probability that a restriction enzyme will cut DNA if the recognition…

A: Given: Recognition sequence for the enzyme: 5' - GGATCC -3' - Every restriction site is a…

Q: What is the difference between an operator and a promoter?

A: Replication is the process by which DNA makes identical copies. Transcription is the formation of…

Q: QUESTION 12 The images shown depict the initiation and elongation steps in protein translation. P.…

A:

Q: Question 12. After transformation by electroporation, you can select transformed bacteria that carry…

A: When a plasmid is successfully transformed into bacteria, the transformed bacteria will have the…

Q: Question 1: While examining a gene related to calcium ion channels in humans (CACNA1S) you discover…

A: D IS THE CORRECT ANSWER. AND EXPLANATION IS GIVEN BELOW .Explanation:

Q: Question 1. What recruits the enzymes that form the 7-methylguanosine 5' cap on the transcript as it…

A: Primary transcript, also known as heterogeneous nuclear RNA (hnRNA), refers to the initial RNA…

Q: DNA primase synthesizes a short RNA primer that later appears at the 5'-end of each Okazaki…

A: The given statement is TRUE

Q: n 3. The resolving power of most matrices used in microcapillary allows the separation of…

A: Microcapillary electrophoresis is a technique for separating DNA fragments based on their size. In…

Q: Spliceosome   Question 24 options:   consists of small nuclear ribonucleoproteins (snRNPs).   is…

A: Scientists are being inspired by RNA sequencing to push the boundaries of current research…

Q: 1- Please write any MRNA sequence that produces protein sequences of 'INFRMATICS'. By using your…

A: Hi! Since you have posted multiple questions and have not mentioned which to answer, we will answer…

Q: Question 4. Which enzyme is used in the processing of miRNAs that are encoded in the genome but NOT…

A: Non coding RNAs (ncRNAs) like as microRNAs and small interfering RNAs (siRNAs) play important roles…

Q: What the gene product

A: Gene regulation in bacteria Introduction We tend to think of bacteria as simple. But even the…

Q: Using the prokaryotic DNA sequence above, describe the relationship between the highlighted regions.…

A: Transcription, the process by which genetic information is converted into RNA molecules, is a…

Q: A) Which of the transcription components must be present during the preincubation to keep the…

A: The term "chromatin" describes the DNA and protein mixture that makes up the chromosomes found in…

Q: Question 13. After electroporating 20 ng of your plasmid into bacterial cells and recovering the…

A: In question 13, out of the total 200 colonies, 150  colonies are white and 50 colonies are blue. So,…

Q: Question 2. Which laboratory method can be used to quantify levels of all mRNAs expressed in samples…

A: RNA sequencing or RNA-seq is a powerful laboratory method used to quantify the expression levels of…

Q: mutagenesis using degenerate

A: 5. Random mutagenesis can also be accomplished by the insertion or deletion of nucleotides from a…

Q: uestion 17. Primers are designed to span introns or bridge an exon-exon junction to avoid genomic…

A: Reverse Transcriptase Polymerase Chain Reaction,l or RT-PCR is a frequently used method in molecular…

Q: Question 15 When you successfully inserted a gene fragment into the Hindill site and transform…

A: Genetic engineering refers to making desired changes in the genome of the organism. Transformation…

Q: Question text A DNA sense strand contains the following nucleotide base sequence: TAC AGC AAT CAC…

A: Transcription is defined as the process of creating an RNA copy of a gene sequence from a DNA…

Q: 2. Justin: A CGT I I C. What is the sequence for this portion of Justin's p53 gene?

A: The Sanger sequencing use chain termination process because it use ddNTPs. When ddNTPs are…

Q: -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAGGCTATATTCACGTGGTACGCTA 3' 3'…

A:

Q: Remodeling complexes use the energy from ATPhydrolysis to change the position of…

A: Chromatin remodeling is the structural modification of chromatin to allow access of condensed…

Q: a.Explain the production of chymosin in a prokaryotic vector and the problems encountered in its…

A: Chymosin is also known as Rennin.  It is a proteolytic enzyme which is related to pepsin that…

Q: QUESTION 9 In a lab, researchers induced a mutation to the Gal3 gene in yeast. The original sequence…

A: Abrupt changes in the DNA sequences are called mutations. these may or may not change the protein…

Q: Genes in the same species that have similar related functions are: a. paralogous b. orthologous c.…

A: The fundamental structural and operational component of inheritance is a gene. DNA is the component…

Q: (1)-Describe the three different methods of horizontal gene transfer among bacteria and mention…

A: INTRODUCTION Three different method of horizontal gene transfer Transformation, Transduction and…

Q: Practice question 1D) In the boxes on the image, label the N and C termini of the çsRu protein. .…

A: The C terminal of protein has a carboxyl group free while the N terminal of a protein has one amine…

Q: UUUUU..3' Rho-independent (intrinsic) terminators in bacterial transcripts consist of a sequence…

A: Intrinsic terminators, often referred to as rho-independent terminators, are sequence patterns…

Q: Please answer very soon will give rating surely Complete Answer needed

A: DNA is the carrier of genetic information in almost all organisms except certain RNA viruses. DNA is…

Q: 5. Describe the method of random mutagenesis using degenerate oligonucleotide primers 6. What are…

A: We are authorized to answer one question at a time since you have not mentioned which question you…

Q: A bacterial cell undergoes a change and the two Trp codons of the tryptophan leader sequence are…

A: Tryptophan operon is an example of repressible operon which remain transcriptionally active and…

Q: Review determining gene function. Match the term and its description. a way of determining gene…

A: Answer 1- a way of determining gene function is in vitro mutagenesis.  Answer 2- a powerful…

Q: n. | Choose | Choose ) ent in situ hybridization nucleic acid probe cing reverse…

A: Gene expression is the process or method by which information of the genes is a passed into nucleic…

Q: Which of the following lists the three steps of translation in their proper sequence? O 1.…

A: Translation is defined as the process of protein synthesis. It takes place in the cytoplasm.

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.