Question #14 Amino acid mutations can in some cases dramatically alter proteinstructure and function. You are working in the lab and make a D to R mutation for a residue on.the surface of your favorite protein. PTP1B. What of the following possible effects would be mostlikely?APTP1B will become more stableBPTP1B will aggregate, since D is not hydrophobic but R is hydrophobic; thus ahydrophobic patch has been introduced on the protein surfacePTP1BS quaternary structure will changeD)PTP1B will elute earlier than it did before from an anion exchangechromatography columnOPTP1B will shift noticeably on an SDS-PAGE gel> 4)

Question #14. Amino acid mutations can in some cases dramatically alter protein structure and function. You are working in the lab and make a D to R mutation for a residue a the surface of your favorite protein. PTP1B. What of the following possible effects would be most likely? MPTP1B will become more etablo (4)

Question #14. Amino acid mutations can in some cases dramatically alter protein structure and function. You are working in the lab and make a D to R mutation for a residue a the surface of your favorite protein. PTP1B. What of the following possible effects would be most likely? MPTP1B will become more etablo (4)

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

Question 12
QUESTION 8 Which of the following statements about how cells control the size of the poly-A tail on mRNA molecules in order to regulate translation initiation is FALSE? To inhibit translation initiation, a protein called CPEB binds to the CPE sequence on the mRNA. This will then bring in an enzyme called PARN. O If a kinase inhibitor was introduced, then Maskin and PARN would be able to continue to exert their inhibitory effect on translation initiation. To initiate translation, the protein CPEB gets phosphorylated by a specific kinase. This causes a conformational change that excludes both Maskin and PARN. If a kinase inhibitor was introduced, then CPEB would be phosphorylated, so no conformational change would occur. Without Maskin and PARN, the poly-A tail can extend and elF4E and eIF4G can interact with each other to initiate translation. O O O O O
Question 7. What are the first three amino acids in the protein that is produced from this gene? -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAGGCTATATTCACGTGGATGGCTAGT... 3' 3' СТААGGCAТААTGTCGTATСCGATATAAGTGCACCTАCCGAТСА. .. 5' Start site
112
Question 32 Which of the following is true of TATA boxes? I. they are found within the core sequence of a gene regulatory sequence II. they are found downstream of the gene being transcribed III. they represent an area of DNA more easily opened than other areas A) I, II, and III B Il and III only c) I and Il only D I and III only
QUESTION 13 Which amino acid below would represent a favorable gain in enthalpy when interacting with the amino acid 'L' in a protein's native conformation? R
Question 3 (1 pt): Which positions in adenine and guanine have the potential to form hydrogen bondsbut are not involved in Watson-Crick base pairing? What might this be used for?1 of 2
Question 2: Part a: Complete the table describing different components of intron removal from mRNA. Nu:, X and Y refer to B-type chemistry shown on the previous page. (YELLOW table shown) Part b: Complete the table describing different components of group I self-splicing intron removal from 26S rRNA in Tetrahymena. (BLUE table shown) Part c: Draw the intron with an all atom structure for Branchpoint A after intron removal from mRNA Part d: Draw the Group I self-splicing intron with an all atom structure for the Guanosine cofactor after intron removal from 26S rRNA in Tetrahymena.
Question 53 Which of the following contains the molecules that are involved in process of transcription? O MRNA, tRNA, and rRNA MRNA, tRNA, DNA, and rRNA O MRNA, tRNA, and DNA MRNA, DNA, and rRNA
Question 6. If cells are infected with a vesicular stomatitis virus (VSV) strain in which a viral gene (VSVG) is fused to the green fluorescent protein gene, when the chimeric protein is synthesized, what compartments will it visit and in what order before until it leaves the cell?
QUESTION 21 Suppose the following are sequences at the 5' splice junction and the 3' splice junction, with intervening intron sequences shown as dashes and the branchpoint A shown, not surprisingly, as 'A'. What is the sequence formed after splicing? 5'-CUCAAUGGUACA- -----CGAUACGAGCACUGACC-3' O A. 5' CUCAAUGCACUGACC 3' O B. 5' CUCAAUGACC 3' O C. 5' CUCAAUGGGCACUGACC 3' O D. 5' CUCAAUGGUGACC 3' O E. 5' CUCAAUGGUACACGAUACGAGCACUGACC 3'
Question 15 About tryptophan: A None of the above statements is right. B It exhibits two carboxylic acid functions and one amide function. |C It is a cyclic amino acid, that strongly ab- sorbs light at 280 nm. D Its 3-letter code is Try and its one-letter code is T. E It is positively charged at pH 12.