Question one parts A though Ea. True / False: Guanine to cytosine intermolecular interactions (hydrogen bonding) is stronger thanadenine to thymine.b. What peptide would be made from the following DNA sequence? 5'ATCCCGGGTACTCACTCCCAT3'Start-Gly-Pro-StopStart-Gly-Ser-Pro-Val-Arg-ValStart-Gly-Gly-Thr-lle-ArgStart-Arg-Arg-Gly-Glyc. Starting from the MRNA strand below - what peptide would be produced? Remember your start andstop codons...5'CCAUGCGGCAUACCAAAUUACUAAACUAGC3'Start-Arg-His-Thr-Lys-Leu-Leu-Asn-StopStart-Asn-Leu-Leu-Lys-Thr-His-Arg-StopStart-Arg-Lys-Leu-Asn-StopPro-Met-Arg-His-Leu-Leu-Asnd. Which type of RNA comprises over 80% of total cellular RNA?ribosomal RNAMessenger RNATransfer RNAe. True / False - All of the DNA nucleotides are attached to the deoxyribose in the BETA configuration (atthe anomeric carbon of the sugar).B (Ctrl) -

Answered: Image /qna-images/answer/6c7a8ea0-8fbf-4312-b5c9-9210f9cc016f.jpg

Answered: Question one parts A though E a. True /…

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

Please convert it to past tense and passive voice. Each group will be provided with two 20 g double-stranded DNA oligomers A and B in STE buffer (0.1M NaCl/ Tris/ 10 mM EDTA, pH 7.4). The sequence of the two oligomers used in this experiment is:5’ GCATTGCGCAGGGCCGAG 3’ (GC rich) 3’ AATGGTACGTATACTTTAT3’ (AT rich)In this experiment, you are going to identity oligomer samples A and B, GC or AT rich, by UV spectrophotometric method.1. Pipet 1 ml of each oligomer into a 1.5 ml Eppendorf tube and label the two tubes A and B.2. The absorption wavelength is 260 nm. Use STE buffer provided to set blank.3. You will be provided with two cuvettes. Use separate cuvette for each DNA sample.4. Transfer 1 ml of DNA sample A to cuvette and measure the UV absorbance at 260 nm (A260) atroom temperature. Repeat this step for Sample B.5. Transfer the DNA back to the original Eppendorf tube, close it and heat it to 45C for 7 minutes.6. Quickly transfer the sample from Eppendorf tube to cuvette, and…
Question 12 Which of the following best explains the relatively more complex folded structure that an RNA molecule assumes? A B с D RNA molecules do not contain a pentose sugar in their backbone, which allows them to be more structurally flexible. RNA molecules contain the nitrogenous base uracil, which can pair with several other ni- trogenous bases in the RNA molecule. RNA molecules contain negatively charged phosphate groups in their backbone, which allows the molecule to bend into complex shapes. RNA molecules are made of only four types of nucleotides, which allows their nitroge- nous base to pair more readily.
QUESTION 4 What percent are the following two 20 amino acid peptides similar? MTEKRVQDKAKLIVDEQACT MTDVRIQERTKLKVFEQLCI O 25% O 25% O 75% 90%
QUESTION 17 A student wanted to run a protein sample on a SDS PAGE gel, and in the process of casting a gel the student had forgotten to add the stacking layer on top of the resolving layer of the gel. What problems would likely arise as a result of this mishap? Proteins would migrate much faster through the gel Proteins would not be able to migrate through the resolving layer and stays at the top of the gel Proteins will move into the resolving layer at different times and this would result in a smear on the gel There is no problem, proteins in the sample would resolve the same as if they were ran on a SDS PAGE gel with a stacking layer on top of a resolving layer QUESTION 18 Sample A is diluted by adding 50 ul to 950 uL of buffer to make solution B. Solution B is diluted by adding 50 uL of solution B to 300 uL of buffer. The absorbance of sample C is 0.05. What is the concentration of sample A assuming the following parameters. |=1 cm Molar extinction coefficient = 10 M-1 cm-1 O 0.7…
QUESTION 23 The pl of hen lysozyme is 11.0; the pl of hen ovalbumin is 4.6. An isoelectric focussing experiment is conducted. Which of these two proteins will migrate closest to the negative pole? hen lysozyme Both proteins will remain at the origin Hen ovalbumin
Question 17
P Question 16 Two peptides have almost the exact same primary structure, except that one has about 10 fewer amino acids at the amino-terminus (N-terminus) of the protein. What is a possible explanation for the protein that is missing those 10 amino acids? O A. An alternative Poly-A tail addition site O B. Leaky scanning occurred O .Differential glycosylation of the protein O D. Inefficient folding by chaperone proteins O E. All of the above are correct answers
QUESTION A test protein contains the following 4 ratios of its amino acid content (mg/g) vs the amino acid content in the adult reference pattern (mg/g): histidine 0.80, isoleucine 0.62, methionine + cysteine 0.50, tryptophan 0.60. What is the test protein's amino acid score (AAS)? O 0.80 O 0.62 O 0.60 O 0.50 O Cannot calculate given this information QUESTION Based on question 25, what is/are the limiting amino acid(s) in this test protein? O Histidine O Isoleucine O Methionine + cysteine O Tryptophan O Cannot calculate given this information QUESTION The test protein referred to in question 25 and 26 has a digestibility of 90%. What is the protein digestibility-corrected amino acid score (PDCAAS)? O 0.80 O 0.56 O 0.50 O 0.45 O Cannot calculate given this information
Question 10. A mRNA contains a codon with the sequence 5'-GAA-3'. Answer A and B for credit. A. What amino acid is encoded by this codon? B. What would be the most likely sequence of the anticodon in the tRNA that recognizes it? Write your answer starting with the 5' end and include 5' and 3' in your answer to get credit.
Question 7: Peptide nucleic acids (PNAS) exhibit greater stability as heteroduplexes with DNA (ie PNA-DNA duplex) than does double-stranded DNA (i.e. DNA-DNA duplex). However, peptide nucleic acids lack charged groups, making them largely insoluble under near-physiological conditions in aqueous buffer. Provide (1) an explanation for the increased stability of PNA-DNA duplexes (hint: consider intermolecular forces). (2) Additionally, propose modification(s) of the PNA scaffold DNA that could increase solubility without drastically reducing duplex stability. PNA R1 HN но. Base Base o=P-O NH Base Base 8 o=P-O- NH 8. Base Base НО NH
Question 1 options: The specificity pocket of the serine protease chymotrypsin, which interacts with Tyr and Phe-containing peptide sequences, contains a Ser residue. A research group is trying to modify chymotrypsin such that it has a low KM with Trp-containing peptides. Enter the name or abbreviation of an amino acid that the Ser could be mutated to that would likely have the desired effect. (Hint: look at the diagrams of the specificity pockets shown in the course slides, and consider how the Ser would need to change to account for the difference between Tyr/Phe and Trp.)
Do question 4 d) d) Calculate the fraction of histidine (amino acid shown below), that has its imidazole side chain protonated at pH 6.4. The pK, value for the imidazole group of histidine is 6.

SEE MORE QUESTIONS

Recommended textbooks for you

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781305961135

Author:

Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Fundamentals of General, Organic, and Biological …

Biochemistry

ISBN:

9780134015187

Author:

John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson

Publisher:

PEARSON

SEE MORE TEXTBOOKS