Question one parts A though Ea. True / False: Guanine to cytosine intermolecular interactions (hydrogen bonding) is stronger thanadenine to thymine.b. What peptide would be made from the following DNA sequence? 5'ATCCCGGGTACTCACTCCCAT3'Start-Gly-Pro-StopStart-Gly-Ser-Pro-Val-Arg-ValStart-Gly-Gly-Thr-lle-ArgStart-Arg-Arg-Gly-Glyc. Starting from the MRNA strand below - what peptide would be produced? Remember your start andstop codons...5'CCAUGCGGCAUACCAAAUUACUAAACUAGC3'Start-Arg-His-Thr-Lys-Leu-Leu-Asn-StopStart-Asn-Leu-Leu-Lys-Thr-His-Arg-StopStart-Arg-Lys-Leu-Asn-StopPro-Met-Arg-His-Leu-Leu-Asnd. Which type of RNA comprises over 80% of total cellular RNA?ribosomal RNAMessenger RNATransfer RNAe. True / False - All of the DNA nucleotides are attached to the deoxyribose in the BETA configuration (atthe anomeric carbon of the sugar).B (Ctrl) -

Answered: Image /qna-images/answer/6c7a8ea0-8fbf-4312-b5c9-9210f9cc016f.jpg

Answered: Question one parts A though E a. True /…

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

Please convert it to past tense and passive voice. Each group will be provided with two 20 g double-stranded DNA oligomers A and B in STE buffer (0.1M NaCl/ Tris/ 10 mM EDTA, pH 7.4). The sequence of the two oligomers used in this experiment is:5’ GCATTGCGCAGGGCCGAG 3’ (GC rich) 3’ AATGGTACGTATACTTTAT3’ (AT rich)In this experiment, you are going to identity oligomer samples A and B, GC or AT rich, by UV spectrophotometric method.1. Pipet 1 ml of each oligomer into a 1.5 ml Eppendorf tube and label the two tubes A and B.2. The absorption wavelength is 260 nm. Use STE buffer provided to set blank.3. You will be provided with two cuvettes. Use separate cuvette for each DNA sample.4. Transfer 1 ml of DNA sample A to cuvette and measure the UV absorbance at 260 nm (A260) atroom temperature. Repeat this step for Sample B.5. Transfer the DNA back to the original Eppendorf tube, close it and heat it to 45C for 7 minutes.6. Quickly transfer the sample from Eppendorf tube to cuvette, and…
Question 12 Which of the following best explains the relatively more complex folded structure that an RNA molecule assumes? A B с D RNA molecules do not contain a pentose sugar in their backbone, which allows them to be more structurally flexible. RNA molecules contain the nitrogenous base uracil, which can pair with several other ni- trogenous bases in the RNA molecule. RNA molecules contain negatively charged phosphate groups in their backbone, which allows the molecule to bend into complex shapes. RNA molecules are made of only four types of nucleotides, which allows their nitroge- nous base to pair more readily.
QUESTION 4 What percent are the following two 20 amino acid peptides similar? MTEKRVQDKAKLIVDEQACT MTDVRIQERTKLKVFEQLCI O 25% O 25% O 75% 90%
Question 10 All of the following are characteristics of Transfer RNA except: O a. Only one loop has the codon that is complementary to the anticodon sequence on mRNA Not yet answered O b. Amino acids are attached at the 3' end Marked out of O c. Each tRNA is used repeatedly during the translation process 1.00 P Flag O d. It's a single strand made of 80 nucleotides, has four regions of base-pairing, and 3 loops question Ое. Anticodon of some tRNAs recognize more than one codon by the wobble base pairing
QUESTION 17 A student wanted to run a protein sample on a SDS PAGE gel, and in the process of casting a gel the student had forgotten to add the stacking layer on top of the resolving layer of the gel. What problems would likely arise as a result of this mishap? Proteins would migrate much faster through the gel Proteins would not be able to migrate through the resolving layer and stays at the top of the gel Proteins will move into the resolving layer at different times and this would result in a smear on the gel There is no problem, proteins in the sample would resolve the same as if they were ran on a SDS PAGE gel with a stacking layer on top of a resolving layer QUESTION 18 Sample A is diluted by adding 50 ul to 950 uL of buffer to make solution B. Solution B is diluted by adding 50 uL of solution B to 300 uL of buffer. The absorbance of sample C is 0.05. What is the concentration of sample A assuming the following parameters. |=1 cm Molar extinction coefficient = 10 M-1 cm-1 O 0.7…
QUESTION 23 The pl of hen lysozyme is 11.0; the pl of hen ovalbumin is 4.6. An isoelectric focussing experiment is conducted. Which of these two proteins will migrate closest to the negative pole? hen lysozyme Both proteins will remain at the origin Hen ovalbumin
Question 26 Which of the following best describes the assembly process to initiate translation in prokaryotes? A small ribosome subunit associates with large subunit; mRNA associates next; IFs bring in first f-Met-tRNA; bound NTP hydrolyzed. B IF w/ bound NTP binds f-Met-tRNA; mRNA associates next; small subunit associates next; bound NTP hydrolyzed; large subunit associates. CIF binds f-Met-tRNA; small ribosome subunit associates next; mRNA associates next; then large subunit; bound NTP hydrolyzed. D small subunit associates with mRNA; IF w/ bound NTP brings in first f-Met-tRNA; IF then hydrolyses bound NTP; large subunit associates
Question 17
P Question 16 Two peptides have almost the exact same primary structure, except that one has about 10 fewer amino acids at the amino-terminus (N-terminus) of the protein. What is a possible explanation for the protein that is missing those 10 amino acids? O A. An alternative Poly-A tail addition site O B. Leaky scanning occurred O .Differential glycosylation of the protein O D. Inefficient folding by chaperone proteins O E. All of the above are correct answers
Question 16 What happens when a stop codon is reached by a ribosome? A termination tRNAter binds to the codon and the growing peptide is transferred to it. When the peptidyl-tRNAter A reaches the P site, the ribosome is signaled to release the protein. The ribosome then is likely to dissociate. A termination tRNAter binds to the codon and the growing peptide is transferred to it. When the peptidyl-tRNAter (B) reaches the P site, the ribosome dissociates. A separate peptidyl transferase then releases the protein from tRNAter. A termination tRNAter binds to the codon and is used to release the growing peptide from the P site TRNA. The ribosome then is likely to dissociate. D A release factor binds to the codon and is used to release the growing peptide from the P site tRNA.
Question 32 Using the genetic code, indicate which polypeptides would be synthesized if poly-UGG were used in a synthetic RNA? NA 2nd potion U postion CAG Phe Ser Tyr Cys Phe Ser Tyr Cys U Leu Ser stop stop Leu Ser stop Trp Leu Pro His Arg Leu Pro His Arg Leu Pro Gin Arg Leu Pro Gin Arg lle Thr Asn Ser lle Thr Asn lle Thr Lys Arg Met Thr Lys Arg Val Ala Asp Gly Ala Asp Gly Val Ala Glu Gly Val Ala Glu Gly Amino Acids A) poly-V B) poly-G poly-W D) poly-Y O A G ၈၈၈၈»nt The
Question 9 The mechanism for all template-directed synthesis of any type of nucleic acid involves which of the following? A nucleophilic attack of a 3' hydroxyl toward a phosphoryl group of a nucleoside triphosphate, releasing PPi. B nucleophilic attack of a 5' hydroxyl toward a phosphoryl group of a nucleoside triphosphate, releasing PPi. nucleophilic attack of a 5' hydroxyl toward a phosphoryl group of a nucleoside triphosphate, releasing PPi. D nucleophilic attack of a 3' hydroxyl toward a phosphoryl group of a nucleoside monophosphate, releasing Pi.

SEE MORE QUESTIONS

Recommended textbooks for you

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781305961135

Author:

Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Fundamentals of General, Organic, and Biological …

Biochemistry

ISBN:

9780134015187

Author:

John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson

Publisher:

PEARSON

SEE MORE TEXTBOOKS