Preimplantation genetic testing for aneuploidy (PGT-A) is meant to identify and discard embryos with chromosome number abnormalities. However, it has not been proven to be valuable in human IVF. What do you think PGT-A is not working as expected
Q: As a genetic counselor, you are asked to assess the risk for a couple with a family history of…
A: Familial adenomatous polyposis is an inherited disease that is autosomal dominant and results in…
Q: What are the advantages and limitations of Y-chromosome STR profiling?
A: There are two type of cell in our body that promotes the over all growth and development, one is the…
Q: What are the potential issues that arise when coding osteoarthritis? When given a complication of…
A: Biology is the study of life as a science. It is a wide natural science with certain unifying themes…
Q: Two homologous chromosomes in ES cells are depicted below with the portion of your gene of interest…
A: CRISPR/Cas9 creates specific double-stranded breaks at the target locus that trigger DNA repair…
Q: Explain what epigenetic theory is.
A: Greek for "epi" means "on or above," thus "epigenetic" refers to elements other than the genetic…
Q: Draw a basket mutant embryo. What does basket encode? Why do the mutant embryos have this phenotype?
A: A mutation is a change in the DNA sequence of an organism. Mutations can result from mistakes in DNA…
Q: discuss the engineered embryronic stem cell method of obtaining gain of function transgenic mice
A: Answer :- Ordinarily, transgenic mice are created by microinjecting the transgenic develop into a…
Q: True or False: 1. The 6X HIS tag is required for a eukaryotic protein to be expressed in E. coli 2.…
A: Polyhistidine tag is added to a protein and helps in its purification. A recombinant protein can…
Q: What is ICSI? Briefly describe one of the ethical concerns of using ICSI to treat infertility in a…
A: A large number of couples are infertile as they are unable to produce children inspite of…
Q: Using illustrations describe the structure of a typical cloning vector and discuss the functions of…
A: "Biotechnology" is the use of our knowledge of biological processes to the development of beneficial…
Q: "If we could turn on telomerase activity in all our cells, we could prevent aging" is true or false.
A: Many potential risks, such as wrinkles, skin folds, a loss of sight, hearing, and sense of smell,…
Q: What is the possible cause of the presence of an extra band in the results of DNA extraction and PCR…
A: This finding suggests that formation of multiple bands in non-denaturing gel electrophoresis is a…
Q: Discuss how a primary mutant screen can identifygenes required for a particular developmental…
A: A gene is a stretch of DNA that contains information of a characteristic. It is the functional key…
Q: When a particular mutagen identified by the Ames testis injected into mice, it causes the appearance…
A: Cancer is considered to be a disease that has abnormal cell growth that can invasive. The cancerous…
Q: What are the key findings of cancer genomics studies as they relate to chromatin biology?
A: Genomics is a branch of biology, which deals with studying and analyzing the structure, evolution,…
Q: hat happens when one nucleiotide is lost or changed from the middle of a gene? Describe to me, or…
A: When a deoxyribonucleic acid factor is destroyed or altered in such the simplest way that the…
Q: Do a few cells created by therapeutic cloning of your own somatic cells constitute life? If these…
A: Somatic cells are those cell which forms the whole body of an organisms, also known as the vegetal…
Q: Take a look at question 3 in More Genetic TIPS. Let’s suppose amale is heterozygous for two…
A: Polymerase chain reaction, or PCR , is a technique to make many copies of a specific DNA region…
Q: Which of the following steps do you take?
A: The process of preserving embryos or ova for later use especially for experimentation involves…
Q: Why is it that somatic gene therapy is allowed in many countries and yet germ-line gene therapy is…
A: Gene therapy is a technique in which genes are used for the prevention and treatment of disease.…
Q: What is using somatic nuclei of transgenic adults to generate other animals with identical genomes?
A: Genomics refers to structure, function, evolution, mapping, and editing of genomes. Somatic cells…
Q: What is a fluorophore? If you wanted to fluorescently label a brain cell, describe one way you could…
A: Introduction Brain cells, also known as neurons, are specialized cells that are the basic building…
Q: Discuss the similarities and differences between X-chromosomeinactivation and genomic imprinting
A: X inactivation refers to the inactivation of all of the genes in one X chromosome in all the somatic…
Q: Determine the size of the DNA you would expect from the restriction digests of the GABRD and GABRD…
A: Gel electrophoresis is a technique used to separate DNA, RNA, or protein molecules based on their…
Q: A C. elegans (nematode) gene called par-1 helps todetermine the AP axis of the animal early in…
A: For several model organisms, "centralized centers" have collections of thousands of genetic stocks,…
Q: Woolly mammoths have been extinct for about 10,000 years, but we often find their well- preserved…
A: Cloning is a process which refers to producing multiple organisms of same type. Researchers have…
Q: What are some unknown and can be an interesting examples of trasgenic organisms present whose genes…
A: Transgenic organisms- transgenic organisms are the organisms whose genes are genetically modified by…
Q: What is genetic engineering? Describe one method genetic engineering can be done (use your book or…
A: Genetics can be defined as the branch of biology which deals with genes, their variation, hereditary…
Q: Transgenic organisms are only possible because widely different organisms share a common mechanism…
A: The genetic engineering allows control by changing genes into an organism. By this technology, we…
Q: Recombinant bacteria can produce hormones that are normally produced in humans. Briefly describe how…
A: Recombinant bacteria or genetically modified bacteria are produced when a gene of interest is…
Q: the role (presence and absence) of a selectable marker (selection) in cloning a recombinant DNA…
A:
Q: This table shows the observations of mutagenesis: Expected count on 10 Actual count Spontaneous…
A: Ethidium bromide (EtBr) is a fluorescent dye that can intercalate between the base pairs in the DNA…
Q: Please answer all parts along with the reason. I'll definitely give a like. Thank you in advance!…
A: If the genes are located on the same chromosome then they are considered as linked genes. The…
Q: Suppose that you could undergo genetic testing at age 18 for susceptibility to a genetic disease…
A: Genetic diseases are caused due to mutations in the genes that are acquired from the parents or can…
Q: Woolly mammoths have been extinct for about 4,000 years, but we often find their well-preserved…
A: Somatic cell nuclear transfer (SCNT) is a technique in which the viable embryo is developed from egg…
Q: What community-based genetic screening programs? What is the intent of such screening programs? Why…
A: A community or population-based genetic screening programme is any type of test performed for the…
Q: methods to introduce gene of interest into plant cells for the production of transgenic crops.
A:
Preimplantation genetic testing for aneuploidy (PGT-A) is meant to identify and discard embryos with chromosome number abnormalities. However, it has not been proven to be valuable in human IVF. What do you think PGT-A is not working as expected
![](/static/compass_v2/shared-icons/check-mark.png)
Step by step
Solved in 2 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- 1) Do you agree or disagree with this statement? Transposons can cause genomic rearrangements or genomic expansion compared to microsats, which are only associated with genomic expansion. Explain your response. 2) Do you agree or disagree with this statement? Since bone is a non-living structure, it would not be useful for genomic profiling. Explain.What is ICSI? Briefly describe one of the ethical concerns of using ICSI to treat infertility in a couple where the male has an AZF deletion mutation.A research group collaborating with the hospital extracted DNA from the peripheral blood leucocytes of the patient V.1, her sister V.2, her mother IV.1 and her father IV.2 with consent and ethical approval for experimental work involving human tissues. These specimens were used for sequencing studies to screen for causative variants in amyloid precursor protein (APP), presenilin-1 (PSEN1) and presenlin-2 (PSEN-2) genes. The outcome is shown in Fig. 2 below. APP IV.1 961 TACGGCGGATGTGGCGGCAACCGGAACAACTTTGACACAGAAGAGTACTGCATGGCCGTG V.2 961 TACGGCGGATGTGGCGGCAACCGGAACAACTTTGACACAGAAGAGTACTGCATGGCCGTG -Y--G--G--C--G--G--N--R--N--N--F--D--T--E--E--Y--C--M--A--V- Amino Acid IV.2 961 TACGGCGGATGTGGCGGCAACCGGAATAACTTTGACACAGAAGAGTACTGCATGGCCGTG 1020 TACGGCGGATGTGGCGGCAACCGGAATAACTTTGACACAGAAGAGTACTGCATGGCCGTG 1020 Amino Acid -YGGCGGNRN NFD TEEY C-M-A-V-340 V.1 961 PSEN-1 IV.1 361 V.2 361 Amino Acid PSEN-2 1020 1020 340 CATACCGACACTCTCCCCCACACACCCCTGCACTCAATTCTCAATCCTCCCATCATCATC 420…
- In contrast with the genomic manipulations of animals and plants described in this chapter, human genetherapy is directed specifically at altering the genomes of somatic cells rather than germ-line cells.Why couldn’t or wouldn’t medical scientists try to alter the genome of human germ-line cells?A couple with a child affected with DBA undergoes in vitro fertilization (IVF) and genetic testing of the resulting embryos to ensure that the embryos will not have DBA. However, they also want the embryos screened to ensure that the one implanted can serve as a suitable donor for their existing child. Their plan is to have stem cells from the umbilical cord of the new baby transplanted to their existing child with DBA, thereby curing the condition. What are the ethical pros and cons of this situation?Not all inherited traits are determined by nuclear genes (i.e., genes located in the cell nucleus) that are expressed during the life of an individual. In particular, maternal effect genes and mitochondrial DNA are notable exceptions. With these ideas in mind, let’s consider the cloning of a sheep (e.g., Dolly). A. With regard to maternal effect genes, is the phenotype of such a cloned animal determined by the animal that donated the enucleatedegg or by the animal that donated the somatic cell nucleus? Explain.
- List three clinical indications for chromosome and/or genome analysis and why the process might be important for each indication.While multiple animal studies have found that food dyes are not associated with no genotoxic effect effects, transient DNA damages occur in the colon of mice treated by amaranth and tartrazine dyes. TRUE OR FALSE Ultra-pasteurized organic milk can last a few weeks (longer expiration date) longer than the week or two that pasteurized conventional milks are labeled with, because that organic milk does not have the additives that conventional milk may have. TRUE or FALSE Red 3 has replaced Red 40 in most foods, because Red 40 could increase the risk of thyroid tumors as shown in some animal studies. TRUE OR FALSE Since the introduction of many pest-resistant GM crops, the usage of glyphosate has declined on conventional agriculture products. TRUE OR FALSEdiscuss the engineered embryronic stem cell method of obtaining gain of function transgenic mice
- True or False: 1. The 6X HIS tag is required for a eukaryotic protein to be expressed in E. coli 2. BAC vectors are an appropriate choice for cloning cDNAs 3. Cluster analysis of micro-array data groups together mRNAs of similar sequence 4. In genomic DNA, on average EcoR1 restriction sites are more common than Mse1 restriction sites 5. Tags such as HA that are fused to proteins always compromise their function.How can telomerase-related aging be addressed therapeutically?Mouse models for human genetic diseases are potentially powerful tools to help geneticists understand thecause of the aberrant phenotypes and develop newtherapeutic measures. However, such mice are not always as useful to investigators as it might seem at firstglance. Suppose that you have a mouse knockoutmodel for a human disease caused by homozygosityfor a null allele of a gene. Discuss how the followingsituations might complicate investigations of the human disease based on this mouse model.a. Mice have a shorter life span than humans.b. Mice homozygous for certain knockout mutationsdie in utero.c. Mouse genomes may have additional copies of thegene whose mutation causes the disease in humans.
![Human Heredity: Principles and Issues (MindTap Co…](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)
![Human Heredity: Principles and Issues (MindTap Co…](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)