population in Africa is mozygous individuals carrying the Val-6 mutation die from sickle cel emia before they can be infected with malaria so it reduced the larial incidence in Africa. squitoes prefer to drink blood from humans with the sickle cell mia trait so the more people with the mutation, the more mosquito re are in the area. ing sickle cell anemia makes one more susceptible to malaria so the go hand in hand with one feeding the other. erozygous individuals carrying the Val-6 mutation are less susceptib nalaria because their red blood cells are resistant to infection by th arial parasite.

Q: Putting everything together, explain how the sickle cell anemia character is maintained at…

A: Introduction Sickle cell anaemia is one of several inherited disorders known collectively as sickle…

Q: Name 2 things the ABO gene codes for besides blood type

A: ABO gene contains 7 exons and is located on the short arm of chromosome number 9.

Q: Which of the following phenotypes is an example of a temperature-sensitive conditional mutation?…

A: Introduction: Mutation refers to the alteration in the nucleotide sequence of the genome in an…

Q: Which of the following mutations would result in higher than normal expression of the trp genes in…

A: In the trp operon, there are three types of hairpin loop structures made with the respective…

Q: Describe the different secondary structures in each model

A: Secondary structure Secondary structure means, the arrangement of amino acid residues in a…

Q: Which of the following genes is believed to have resulted from a favorable mutation, and has been…

A: A favorable mutation is a genetic alteration that enhances an organism's ability to survive and…

Q: None

A: Links for…

Q: Transgenic animals used to produce insulin today are Saccharomyces cerevisiae Carthamus tinctorius O…

A: Introduction   Transgenic animals:- These are animals in which there has been a deliberate…

Q: In chipmunks, the relationship between genotype and the age at which heart attacks occur is similar…

A: Co-dominance is the term used to describe the genetic phenomena here.

Q: gene is usually zed to the clotting when a blood emophilia A, occurs the gene will express women.…

A: Hemophilia is a rare condition in which the blood does not clot properly due to a lack of…

Q: On average, how many mutations different are we from our parents? O only 1 or 2 O 10-30 O 40-50 O…

A: Mutations are the changes in DNA sequence. Based on the location of the mutation, it can be silent…

Q: In the "Suburban Landscape" video, Andres Duany states that "suburbia disaggregates the elements of…

A: Urban planning and the development of living spaces have advanced altogether over time, with…

Q: Which of the following is NOT true for proto-oncogenes? O cause a gain in function O mutations are…

A: Proto-oncogenes are those genes that under normal conditions help the cell to grow but when they are…

Q: Below you will find the normal p53 gene found on chromosome 17 and a mutated version of the gene.…

A: To solve such questions, we should know the corresponding complementarity between the bases and that…

Q: cD,cd 'In a cross between AabbXcx° and AaBoXY A controls earwat where wet earwax is dominant to dry…

A: AaBbXCDXCd  *  AaBbXcDY Wet earwax - A Dry earwax - a Tasting - B Non-tasting - b color-vision - C…

Q: Epistasis Hypostatic gene Epistatic gene Dominant epistatic ratio Recessive epistatic ratio Lethal…

A: Genetics is the scientific study of genes, heredity, and variation in living organisms. It is…

Q: UV irradiation results in a mutation in a skin cell in the location mark karyotype. 器 XX 8 88 88 路路…

A: The chromosomal collection of an individual is defined as the karyotype. It is a pictorial…

Q: Which of the following is a true statement? BRCA-1 and BRCA-2 mutations decrease risk of breast as…

A: Breast cancer is a complex and significant health issue that affects millions of women worldwide.…

Q: he following statements is FALSE [ Select] [Select ] Sickle-cell anemia results in lower oxygen…

A: Sickle Cell anaemia is an autosomal recessive disease in which the hemoglobin is affected and…

Q: What will be the effect of mutation that turns lysine to arginine

A: The mutations occur in genomic DNA but they will reflect in the form of protein sequence and…

Q: How does the GA(T>C)A mutation in the Duffy promoter provide malaria resistance? Podused Diff

A: A protozoan parasite and human pathogen that most frequently causes malaria is known as Plasmodium…

Q: (select all correct answers) Which of the following mutant lambda phages can still go to lysogenic…

A: Option b is the right answer.

Q: Of all the genes in the human genome, the ones withthe most characterized Alu insertions are those…

A: Introduction  Transposons are the short highly repeated DNA sequence present in heterochromatic…

Q: What is the significance of this?

A: Sickle-cell anemia is a condition of the body in which the red blood cells change their shape from…

Q: D) What is the probability that a male-young will have both the eye disease and the Xb antigen?

A: Howler monkeys are arboreal, meaning they primarily live in trees, and they are primarily…

Q: The promoters on genes encoding early proteins in viruseslike T4 have a different sequence than the…

A: Virus is a microorganism that is smaller when compared to a bacterium. They lack the ability to…

Q: What is the most likely reason a southern blot may not be able to detect KSS in the clinic? O A…

A: Kearns-Sayre syndrome (KSS) is a mitochondrial myopathy with a typical onset before 20 years of age…

Q: Determine the results of an insertion of TA between positions 2 and 3.

A: 5' GTAGGGAGAACGAGACAATCTG  3' DNA 3' CATCCCTCTTGCTCTGTTAGAC  5'   5'GUAGGGAGAACGAGACAAUCUG 3' mRNA…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.