phosphodiester bonds 8 0-2-0-3 O HCS H₂C 8-6-0 H₂C OH O 0-6-0 H₂C OH O 2 purine pyrimidine T Strand X OH CH₂ -0-1-0 CH₂ -0-6-0 CH₂ 64110 CH₂ O 1-1-0.

Q: O II O-P-O- 0™ Phosphate HOCH₂ H H Base- -CH₂ H OH OH H OH H Deoxyribose (in DNA) H- HOCH₂ H H O H…

A: Ribose and deoxyribose are five-carbon sugars that play important role in the structure of nucleic…

Q: which one is nucleoside - amoino acid- de novo synthesis - nucleotide - salvage

A: Nucleotides and nucleosides: Nucleic acids such as DNA and RNA are polynucleotides. They are chains…

Q: Syntesis of the heaction H;C-OCOR H,C-OH R'COO Na* NaOH НС—ОСOR? НС—ОН + R'COO Na* H2Ċ-OCOR H2C-OH…

A: Introduction Hydrolysis of triacylglycerols with the alkali NaOH or KOH yielding salts of free fatty…

Q: expanded structure of the D-tagatose Fischer projection of D-tagatose Haworth projection of…

A: The objective of the question is to understand the different structural representations of…

Q: 8. DNA basic structure: Below, I have drawn a representation of a single strand of DNA. Draw a…

A: The self replicating molecules that are present in the chromosomes and carry genetic information are…

Q: What monomer gets added into DNA? Deoxyribonucleoside pentosephosphate  Nucleotide triphosphate…

A: Nucleotides are the building blocks of DNA and RNA. DNA contains deoxyribose sugar while RNA…

Q: How many hydrogen bonds exist between this DNA strand and its complementary strand? I and…

A: In the 1950s, Erwin Chargaff, a biochemist, discovered that the nitrogenous bases (A, T, C, and G)…

Q: C4GUCAGUCAGUCO/ Use the codon chart to determine the following RNA strand in amino acids (Remember…

A: Genetic code The relationship between the sequence of amino acids in a polypeptide chain and…

Q: Label the following -phosphodiester bond -AT base pair -hydrogen bond -deoxyribose sugar -GC base…

A: DNA is a nucleic acid which also acts as genetic material. It is made up of deoxyribose, a pentose…

Q: 14.11) Fill in the missing one-letter abbreviations for the organic bases in the image below to show…

A: DNA stands for Deoxyribonucleic Acid. It is a molecule that contains the genetic instructions used…

Q: in . Label the drawing at the right with the terms nucleotide, base pairing rules, and double helix.…

A: There are two types of nucleic acids present in our body, DNA and RNA. DNA or deoxyribo nucleic acid…

Q: Give the sequence of the complementary DNA strand for the DNA chain with the following base sequence…

A: DNA means deoxyribonucleic acid. DNA acts as the genetic material in most of the organisms present…

Q: Indicate the parts of the diagram which represent the covalently bonded backbone of the nucleic id.…

A: DNA(deoxyribonucleic acid) is a double-stranded helical genetic material containing thousands of…

Q: 3. Identify if the following is a pyrimidine/purine nucleotide or a pyrimidine/purine nucleoside and…

A: Hi, Thankyou for posting your question on Bartleby. As per the guidelines we are allowed to answer…

Q: Why is agarose an ideal gel matrix for electrophoresis experiments? Because it forms a liquid at all…

A: Nucleic acids are negatively charged molecules because of the phosphate backbone. Due to their…

Q: Which of the following statements about polynucleotide formation is correct? As a polymer, DNA is…

A: given are some statements regarding polynucleotide formation and the correct among them is given…

Q: nscript: 3' TACAGTTAAGGCTCCACTGTTA 5' 5' 3' ino Acid Sequence (ex. Met-Trp- and so on) Second letter…

A: The genetic code is the relationship between the sequence of bases in DNA and the sequence of amino…

Q: 3. Below is the structure of a nucleotide triphosphate. of of of O ATP R-O- R-O O R-O O O O O +|| O…

A: Nucleotides are organic molecules that form the basic building blocks of nucleic acids (DNA and…

Q: 5’ - A T G    G C C    C A A    C T G    A C C - 3’ a. How many nucleotides are listed here b. How…

A: Transcription is the process by which the genetic information encoded in DNA is copied into a…

Q: One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base…

A: Introduction DNA is the molecular structure that is composed of a pair of polynucleotide chains…

Q: On the diagram of this DNA molecule, match the letters to the corresponding components: (should only…

A: In the diagram below DNA is shown. DNA is made up of a monomer called nucleotide. Each nucleotide…

Q: nomenclature. o=-o- NH. 0- 0=P-O

A: Nucleic acids are the polymer of nucleotide. So, nucleic acids are also called as the…

Q: 1. What would be the amino acid sequence encoded by the MRNA 5'CCAUGACGUCGGAUCAAUGAGC 3' 2. If the…

A: DNA replication is the process in whichbbhvgvhghhccvfgcbgvh

Q: 1. Which of the following is true about phosphodiester linkage? a) 3'-phosphate group of one…

A: Phosphodiester linkage is the covalent bond that connects two nucleotides in a DNA or RNA strand. It…

Q: A DNA nucleotide is composed of what three parts and are held together by

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Daughter strand 5' end 5-CH₂ CH₂ s s s OH CH₂ 3′ ÓH TE 3' end 3' end T OH 3 H₂C H₂C H₂C 5' end…

A: The question is asking about the direction of growth of the daughter strand during a synthesis…

Q: The following is diagram of a generalized tetranucleotide. Carbons exist at corners on the shapes…

A: DNA is the nucleic acid in the cell, which resides in the nucleus. It consists of the sequence of…

Q: I need help because i don't get it. Can you help me to explain to me, please?

A: DNA It refers to the molecule that constitutes genetic information that is passed from generation ot…

Q: Modify methionine to show its zwitterion form.

A: Here an amino acid "Methionine" is given which has following structure:-

Q: Phosphate Sugar G A Bases O CCCACTTGAG O GAGTTCACCC O GGGTGAACTC OCTCAAGTGGG O None of the Above…

A: Nucleic acids are biomolecules that store genetic information and help pass it from one generation…

Q: Glucose and galactose are O C4 epimers O Cl anomers O C5 epimers O C3 epimers O C2 epimers

A: Carbohydrates are sugar molecules and are one of the major nutrients that are required by our human…

Q: Draw and label the following RNA tetranucleotide: 5’phosphoryl-A-2’O-methyl-C-U-G-3’-phosphate

A: DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) are polynucleotides, i.e., they are polymers…

Q: 47. Is the following a polymer of DNA or RNA? Explain how you can determine this. (Give two pieces…

A: RNA is ribonucleic acid which is made up of ribo nucleotides. RNA is single stranded molecule with…

Q: he joining of a new nucleotide to a growing strand during DNA synthesis leads to the formation of a…

A: In molecular biology, DNA replication is an important procedure that occurs in the eukaryotic cell's…

Q: The structure forms basenpair with what specific nucleobase?

A:

Q: DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’, whats the non-template/sense/coding strand from the STARND…

A: During the process of transcription, one of the two DNA strands serves as a template for the…

Q: The coding (sense) strands of several DNA molecules have the base sequences in the table below.…

A: The melting temperature of a DNA depends on the number of hydrogen bonds that bind these double…

Q: draw the structure of the polynucleotide GT

A:

Q: Given the structures of the ribonucleotides as (shown in Image A) and deoxyribonucleotides (as shown…

A: Explain;- The polyribonucleotide UAGCCUG consists of six nucleotides, each of which contains a…

Genomic studies

Genomic studies (genomics) is the study of the whole genome of an organism. Using bioinformatics and high-performance computing, genomic researchers examined massive amounts of deoxyribonucleic acid (DNA)-sequence data to discover variations or mutations that affect drug response, health, or disease. Genomics is a much younger discipline than genetics, having only emerged in the last few decades as a result of technological advancements in DNA sequencing and computational biology.