Part C - Exploring antiparallel 3 sheet structure The hydrogen bonding between antiparallel sheets, also visible in the pdb by selecting the antiparallel sheet view, is shown. Locate the N- and C-termini in this image. Select the antiparallel sheet view in the pdb file. How many peptide chains are shown? O 1 O 2 3 O 4 Submit Request Answer

Part C - Exploring antiparallel 3 sheet structure The hydrogen bonding between antiparallel sheets, also visible in the pdb by selecting the antiparallel sheet view, is shown. Locate the N- and C-termini in this image. Select the antiparallel sheet view in the pdb file. How many peptide chains are shown? O 1 O 2 3 O 4 Submit Request Answer

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 8P

See similar textbooks

Related questions

Q: What is a Ramachandran Plot?

A: Ramachandran plot is developed by G N Ramachandran, C Ramakrishnan and V Sasisekharan in 1963. This…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: 5’ GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG 3' From above sequence…

Q: affinity

Q: (a) 1 Normalized fluorescence 0.8 0.6 0.4 0.2 0 50 55 OM 0.100 M 0.200 M 0.300 M 0.500 M 1.00 M 2.00…

A: There are four classes of biological macromolecules - proteins, nucleic acid, lipids and…

Q: A ribbon diagram of a zinc metallo-beta-lactamase protein is shown. Label the secondary structures.

A: Proteins are composed of twenty standard amino acids attached together via peptide bonds. The linear…

Q: 11- During the acid hydrolysis of a protein (6N HCl at 110°C for 24, 48 and 72 hours) to determine…

A: The acid hydrolysis of protein is generally carried out using strong acid like HCl that breaks the…

Q: Do not use Ai

A: Step 1: Step 2: Step 3: Step 4:

Q: 10. Explain the difference at the molecular level in how temperature and urea denature a protein.

A: The three dimensional structure of a protein is held together by noncovalent interactions like…

Q: Problem: From the following information determine the amino acid sequence of a peptide. N-terminal…

A: When a polypeptide undergoes edman degradation it gives PTH derivative of an amino acid residue. The…

Q: (a) 1 Normalized fluorescence 0.8 0.6 0.4 0.2 0 50 55 OM 0.100 M 0.200 M 0.300 M 0.500 M 1.00 M 2.00…

A: SYPRO Orange is a fluorescent molecular probe that binds to hydrophobic surfaces non-specifically…

Q: Referring back to the quaternary level proteins, list and describe the modifications that can be…

A: The structure of protein includes sequence of amino acids in a polypeptide chain. The formation of…

Q: Which amino acid sequence will form part of which protein structure, and why? Sequence 1:…

A: Proteins are macromolecules made up of L-amino acids. They are presently more than any other major…

Concept explainers

Nucleotides

It is an organic molecule made up of three basic components- a nitrogenous base, phosphate,and pentose sugar. The nucleotides are important for metabolic reactions andthe formation of DNA (deoxyribonucleic acid) and RNA (ribonucleic acid).

Nucleic Acids

Nucleic acids are essential biomolecules present in prokaryotic and eukaryotic cells and viruses. They carry the genetic information for the synthesis of proteins and cellular replication. The nucleic acids are of two types: deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). The structure of all proteins and ultimately every biomolecule and cellular component is a product of information encoded in the sequence of nucleic acids. Parts of a DNA molecule containing the information needed to synthesize a protein or an RNA are genes. Nucleic acids can store and transmit genetic information from one generation to the next, fundamental to any life form.

Question

Part C - Exploring antiparallel 3 sheet structure
The hydrogen bonding between antiparallel sheets, also visible in the pdb by selecting the antiparallel sheet view, is shown. Locate the N- and C-termini in this image.
Select the antiparallel sheet view in the pdb file. How many peptide chains are shown?
O 1
O 2
3
O 4
Submit
Request Answer

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1: Introduction of antiparallel beta sheet structure.

VIEW

Step 2: Explanation of the antiparallel beta sheet structure.

VIEW

Solution

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

please help
Small molecules are used as inhibitors of protein action - as drugs. They most often do this by blocking the active site within the protein. Potential drugs can be screened computationally to determine if they are strongly bound to the protein. Figure 1 shows a possible conformation of a candidate drug molecule, 4-bromo-2- carboxymethylamide-pyrrole (abbreviation: BCMAP) at the active site of a protein (abbreviation: PR). Figure 2 shows the full protein structure whilst figure 3 shows a known inhibitor of the protein at the site, overlayed with another calculated conformer of BCMAP. (c) Outline how you would investigate whether BCMAP would be an effective inhibitor for the protein in competition with the molecules that the protein normally targets, and any solvent. Figure 1. 4-bromo-2-carboxymethylamide-pyrrole (BCMAP) (C, N, O, and Br atoms in yellow, blue, red, and brown, respectively) in the active site of the protein structure.
Chymotrypsin digestion, separation of peptides, and Edmann technique give the sequences for peptide fragments as follows: C-1 G-A-E-A-T-E C-2 G-K-V-G-A-H-A-G-E-Y C-3 V-L-S-P-A-K-T-N-V-K-A-A-W What is the sequence for the peptide? NOTE: Label the fragments when reconstructing the peptide chain e.g. for trypsin T-1, T-2 etc...
Part B/D?
Part E - Exploring parallel sheet structure and hydrogen bonding patterns A different segment of a 3 sheet found in GFP has two parallel strands. The hydrogen bonding between parallel sheets, also visible in the pdb by selecting the parallel sheet view, is shown. First, locate the N- and C-termini in this image. Next, look for a pattern in the hydrogen bonding in parallel 3 sheets Select the parallel sheet view in the pdb file. Complete the sentences describing the relationship between the two strands making up the sheet. Match the words in the left column to the appropriate blanks in the sentences on the right.
What is the function of sodium dodecyl sulfate (SDS) in SDS-PAGE? stabilizes the gel matrix, improving resolution during electrophoresis SDS solubilizes proteins to give them uniformly negative charges, so the separation is based purely on size. SDS raises the pH of the gel, separating multiunit proteins into individual subunits. SDS solubilizes proteins to give them uniformly positive charges, so separation is based purely on pH.
Please not hand written solution
Please don't provide handwriting solution
1
Give detailed Solution with explanation needed (no need Handwritten answer
Given the description of four different proteins above: Which protein will have the highest mobility in an SDS-PAGE gel?
What to submit: Draw in the hydrogen bonds for parallel and antiparallel sheets and replace the current image with new ones. Underline the correct sheet type. Submit as an image or PDF. Label the amino acids in the following peptide using their three-letter and one letter code H₂N OH Three Letter Code - One Letter Code - ZI IZ ZI NH₂ Draw out the following peptide (CHARLIE) from N to C terminus. Draw by hand and upload as a file attachment. What is the net charge of your peptide? net charge:+