Part C - Exploring antiparallel 3 sheet structure The hydrogen bonding between antiparallel sheets, also visible in the pdb by selecting the antiparallel sheet view, is shown. Locate the N- and C-termini in this image. Select the antiparallel sheet view in the pdb file. How many peptide chains are shown? O 1 O 2 3 O 4 Submit Request Answer

Part C - Exploring antiparallel 3 sheet structure The hydrogen bonding between antiparallel sheets, also visible in the pdb by selecting the antiparallel sheet view, is shown. Locate the N- and C-termini in this image. Select the antiparallel sheet view in the pdb file. How many peptide chains are shown? O 1 O 2 3 O 4 Submit Request Answer

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 8P

See similar textbooks

Related questions

Q: What is a Ramachandran Plot?

A: Ramachandran plot is developed by G N Ramachandran, C Ramakrishnan and V Sasisekharan in 1963. This…

Q: what is the c-terminal AA residue? use one-letter code for amino acid

A: The amino acid can be defined as the organic compound that comprises an amino group at one end and a…

Q: H. Me Call wall bullding block D-Ala-D-Alal-Lys-tail Me Heptapeptide backbone Ri O. R H. R2 i)…

A: Vancomycin is a glycopeptide antibiotic used to treat a number of bacterial infections. It acts by…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: 5’ GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG 3' From above sequence…

Q: affinity

Q: (a) 1 Normalized fluorescence 0.8 0.6 0.4 0.2 0 50 55 OM 0.100 M 0.200 M 0.300 M 0.500 M 1.00 M 2.00…

A: There are four classes of biological macromolecules - proteins, nucleic acid, lipids and…

Q: A ribbon diagram of a zinc metallo-beta-lactamase protein is shown. Label the secondary structures.

A: Proteins are composed of twenty standard amino acids attached together via peptide bonds. The linear…

Q: 11- During the acid hydrolysis of a protein (6N HCl at 110°C for 24, 48 and 72 hours) to determine…

A: The acid hydrolysis of protein is generally carried out using strong acid like HCl that breaks the…

Q: Do not use Ai

A: Step 1: Step 2: Step 3: Step 4:

Q: Suppose you have two genetic variants of a large protein that differ only inthat one contains a…

A: Histidine is an amino acid; amino acids are used to make proteins and enzymes in the body. It is…

Q: what is the n-terminal AA residue? use one-letter code for amino acid

A: The N-terminal amino acid residue is the amino acid that is present in the N-terminal. For protein…

Q: 10. Explain the difference at the molecular level in how temperature and urea denature a protein.

A: The three dimensional structure of a protein is held together by noncovalent interactions like…

Q: Problem: From the following information determine the amino acid sequence of a peptide. N-terminal…

A: When a polypeptide undergoes edman degradation it gives PTH derivative of an amino acid residue. The…

Q: I'm conducting an experiment concerned with the binding affinity of tretinoin (all trans retinoic…

A: Fluorescence resonance energy transfer (FRET) is a mechanism of energy transfer between two light…

Q: (a) 1 Normalized fluorescence 0.8 0.6 0.4 0.2 0 50 55 OM 0.100 M 0.200 M 0.300 M 0.500 M 1.00 M 2.00…

A: SYPRO Orange is a fluorescent molecular probe that binds to hydrophobic surfaces non-specifically…

Q: Referring back to the quaternary level proteins, list and describe the modifications that can be…

A: The structure of protein includes sequence of amino acids in a polypeptide chain. The formation of…

Q: Which amino acid sequence will form part of which protein structure, and why? Sequence 1:…

A: Proteins are macromolecules made up of L-amino acids. They are presently more than any other major…

Concept explainers

Nucleotides

It is an organic molecule made up of three basic components- a nitrogenous base, phosphate,and pentose sugar. The nucleotides are important for metabolic reactions andthe formation of DNA (deoxyribonucleic acid) and RNA (ribonucleic acid).

Nucleic Acids

Nucleic acids are essential biomolecules present in prokaryotic and eukaryotic cells and viruses. They carry the genetic information for the synthesis of proteins and cellular replication. The nucleic acids are of two types: deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). The structure of all proteins and ultimately every biomolecule and cellular component is a product of information encoded in the sequence of nucleic acids. Parts of a DNA molecule containing the information needed to synthesize a protein or an RNA are genes. Nucleic acids can store and transmit genetic information from one generation to the next, fundamental to any life form.

Question

Part C - Exploring antiparallel 3 sheet structure
The hydrogen bonding between antiparallel sheets, also visible in the pdb by selecting the antiparallel sheet view, is shown. Locate the N- and C-termini in this image.
Select the antiparallel sheet view in the pdb file. How many peptide chains are shown?
O 1
O 2
3
O 4
Submit
Request Answer

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1: Introduction of antiparallel beta sheet structure.

VIEW

Step 2: Explanation of the antiparallel beta sheet structure.

VIEW

Solution

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Antiparallel B sheet 寧 ; Ala side chains Gly side chains Figure 4-14a Lehninger Principles of Biochemistry, Seventh Edition 2017 W. H. Freeman and Company The structure of spider silk is shown above. Mutating the alanine residues to arginine is expected to disrupt the beta sheet structure. Please provide two reasons why mutating the alanine residues to arginine would be expected to disrupt the beta sheet structure.
please help
Small molecules are used as inhibitors of protein action - as drugs. They most often do this by blocking the active site within the protein. Potential drugs can be screened computationally to determine if they are strongly bound to the protein. Figure 1 shows a possible conformation of a candidate drug molecule, 4-bromo-2- carboxymethylamide-pyrrole (abbreviation: BCMAP) at the active site of a protein (abbreviation: PR). Figure 2 shows the full protein structure whilst figure 3 shows a known inhibitor of the protein at the site, overlayed with another calculated conformer of BCMAP. (c) Outline how you would investigate whether BCMAP would be an effective inhibitor for the protein in competition with the molecules that the protein normally targets, and any solvent. Figure 1. 4-bromo-2-carboxymethylamide-pyrrole (BCMAP) (C, N, O, and Br atoms in yellow, blue, red, and brown, respectively) in the active site of the protein structure.
Chymotrypsin digestion, separation of peptides, and Edmann technique give the sequences for peptide fragments as follows: C-1 G-A-E-A-T-E C-2 G-K-V-G-A-H-A-G-E-Y C-3 V-L-S-P-A-K-T-N-V-K-A-A-W What is the sequence for the peptide? NOTE: Label the fragments when reconstructing the peptide chain e.g. for trypsin T-1, T-2 etc...
Part B/D?
Please answer fast 1) Amino acid sequence of a heptapeptide gave thefollowing information Asp, leu, lys, ,met, phe and Tyra) Trypsin had no effectb) PITC analysis gave the phenyl alanine derivativec) Chymotrypsin (which cleaves after aromatic amino acids) gave a dipeptide and atetrapeptide, which contained Leu, Lys and Metd) Cyanogen bromide, which cleaves after methionine residues, gave a dipeptide,tetrapeptide and free lys What is the sequence?
(c) The tube and cylinder diagram to the right illus- trates schematically the potassium channel protein from a bacterium. This channel protein consists of four identical polypeptide chains each comprised of 119 residues. The cyan ribbon illustrates only two of the polypeptide chains. The relative positions of 4 α-helices, one from each poly- peptide chain, are shown as cylinders. The red sphere in the central part of the diagram shows the position of a potas- sium ion identified by X-ray structure analysis. A cesium ion (green sphere) was also found to be stabilized in the same position when cesium chloride was introduced into the crys- tals. The cylinders each represent an α-helix running from Tyr62 to Thr74. Considering the position of the potassium ion, in- dicate on one of the cylinders at which end of the cylinder residue Tyr62 is found and at which end residue Thr74 is found. Explain the basis of your answer? Ala23 Thr119 (d) The N- and C-terminal residues of one of the…
What is the function of sodium dodecyl sulfate (SDS) in SDS-PAGE? stabilizes the gel matrix, improving resolution during electrophoresis SDS solubilizes proteins to give them uniformly negative charges, so the separation is based purely on size. SDS raises the pH of the gel, separating multiunit proteins into individual subunits. SDS solubilizes proteins to give them uniformly positive charges, so separation is based purely on pH.
6-One method to determine proximity of two locations in a protein molecule or protein complex is FRET. This technique uses fluorescence transfer between two fluorophores where the ability of the transfer to occur is correlated to distance between the two residues. A) On the following graph using colored pencils, pens, or markers draw the emission spectra from the donor and the absorbance spectra of the acceptor (this should be a general schematic, does not need to be a FRET pair). Include a key for your graph B) As a rescarch student in my group you want to study the proximity of two residues in clamp region of a protein. Draw a schematic of your protein and label the two locations of your fluorophores. In 2-4 sentences (or figures) explain how your FRET fluorophores would give determine if these two residues were close to one another.
typed answer and atremt all please
I. A protein, X, was Isolated from a pathogenlc mlcroorganism. The proteln Is a vlrulence factor whose path0genlclty lies In a heptapeptide of unknown sequence. After trypsin cleavage of the heptapeptide from protein X, the peptlde's compOsition and sequence was determined. The fOllowing were the results of the sequenclng process: 1. When the peptide was treated with dinitrofluorobenzene (DNFB), DNP-asp and a mixture of amino acids were produced. 2. When the same Intact peptide was treated with streptococcal protease, a pentapeptide of composition asp, asN, cys, gly and ser and 2 amlno acids were released. 3. When the heptapeptlde was also treated with hydrOxylamine HCI, a tripeptide and a tetrapeptide were obtained. The C-terminal amino acid of the tripeptide was asN. 1) What is the sequence of the heptapeptide if it is composed of cys, asp, lys, asN, gly and ser only? 2) What is the pl of the heptapeptide?
Please not hand written solution