Biology (MindTap Course List)
11th Edition
ISBN: 9781337392938
Author: Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 3.5, Problem 1C
VISUALIZE Sketch a pyrimidine
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
please help
In your own words
Original sequence:
Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start):
5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’
Question:
4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this?
5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3
Chapter 3 Solutions
Biology (MindTap Course List)
Ch. 3.1 - Describe the properties of carbon that make it the...Ch. 3.1 - Define the term isomer and distinguish among the...Ch. 3.1 - Identify the major functional groups present in...Ch. 3.1 - Explain the relationship between polymers and...Ch. 3.1 - What are some of the ways that the features of...Ch. 3.1 - Prob. 2CCh. 3.1 - Prob. 3CCh. 3.1 - Prob. 4CCh. 3.1 - Prob. 5CCh. 3.2 - Distinguish among monosaccharides, disaccharides,...
Ch. 3.2 - VISUALIZE Draw simple sketches comparing the...Ch. 3.3 - Distinguish among fats, phospholipids, and...Ch. 3.3 - Prob. 1CCh. 3.3 - Explain why the structure of phospholipids enables...Ch. 3.4 - Give an overall description of the structure and...Ch. 3.4 - Prob. 8LOCh. 3.4 - Distinguish among the four levels of organization...Ch. 3.4 - Prob. 1CCh. 3.4 - Prob. 2CCh. 3.5 - Describe the components of a nucleotide. Name some...Ch. 3.5 - VISUALIZE Sketch a pyrimidine nucleotide subunit...Ch. 3.6 - Compare the functions and chemical compositions of...Ch. 3.6 - How can you distinguish a pentose sugar from a...Ch. 3 - Prob. 1TYUCh. 3 - VISUALIZE The structures depicted are (a)...Ch. 3 - Prob. 3TYUCh. 3 - The synthetic process by which monomers are...Ch. 3 - A monosaccharide designated as an aldehyde sugar...Ch. 3 - Structural polysaccharides typically (a) have...Ch. 3 - Saturated fatty acids are so named because they...Ch. 3 - Fatty acids in phospholipids and triacylglycerols...Ch. 3 - Which of the following levels of protein structure...Ch. 3 - Which of the following associations between R...Ch. 3 - Each phosphodiester linkage in DNA or RNA includes...Ch. 3 - PREDICT Do any of the amino acid side groups shown...Ch. 3 - PREDICT Like oxygen, sulfur forms two covalent...Ch. 3 - Hydrogen bonds and van der Waals interactions are...Ch. 3 - EVOLUTION LINK In what ways are all species alike...Ch. 3 - EVOLUTION LINK The total number of possible amino...Ch. 3 - EVOLUTION LINK Each amino acid could potentially...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Give explanation of correct option and explanation of incorrect options. Hand written solutions are strictly prohibited.arrow_forwardFigure 3 represents one process that occurs during protein synthesis. amino acid molecule Q A UGC C GỤ AC C GAC Ų (a) Name the process shown. (b) Identify the molecule labelled Q. (c) In Figure 3, the first codon is AUG. Give the base sequence of the complementary DNA base sequence and the missing anticodon. Table 1 shows the base triplets that code for two amino acids. Table 1 Amino acid Encoding base triplet Aspartic acid GAC, GAU Proline CCA, CCG, CCC, CCU Aspartic acid and proline are both amino acids. (d) Describe how two amino acids differ from one another. You may use a diagram to help your description. (e) Deletion of the sixth base (G) in the sequence shown in Figure 3 would change the nature of the protein produced but substitution of the same base would not. Use the information in Table 1 and your own knowledge to explain why.arrow_forwardWe have talked about several examples of cis-acting elements that have dyad symmetry (inverted repeat symmetry). Some function on the level of DNA, and others function on the level of RNA. Give one example of one that functions at the DNA level and briefly explain why the sequence requires dyad symmetry to work properly. Note: you don't have to give an exact sequence, just the name of the element. Edit View Incort Format Tools Tabloarrow_forward
- Consider the following in light of the concept of levels of structure (primary, secondary, tertiary, quaternary)as defined for proteins.(a) What level is shown by double-stranded DNA?(b) What level is shown by tRNA?(c) What level is shown by mRNA?arrow_forwardSelect TRUE or FALSE for each of the following statements: 1. Only one of the three phosphate groups present in each nucleotide precursor remains present in a DNA polymer. 2. Starch and cellulose are alike in that both contain sugars bonded together in identical ways. 3. The coding strand of DNA is complementary in sequence to the corresponding MRNA. 4. Ribosomal RNA (rRNA) is synthesised by ribosomes in the process of translation. 5. Polyribosomes speed up the rate of transcription.arrow_forwardWhat are the complementary base pairs in DNA-RNA interactions? Answer format: Base 1(one letter symbol)-Base 2 (one letter symbol, or B-B*(hypothetical N-base) In the lengthening of a polynucleotide chain, which type of nucleotide subunit (name please not the formula) would bond to its 3’ end? How many 3’,5’-phosphodiester linkages are present in a tetranucleotide segment of a nucleic acid?arrow_forward
- This activity breaks down protein synthesis using the metaphor of PIZZA! Use your Amino Acids Reference Sheet to complete the following table. Fill in the blank spaces of each row with either the missing DNA triplet, the mRNA codon, or the Amino Acid. While there are actually multiple codons that code for any one amino acid, for this activity there only needs to be one DNA triplet and one corresponding mRNA codon recorded for each amino acid. Remember: RNA uses uracil (U) instead of thymine (T)! TTG GGG CGT AAA TTT CAA DNA AAC UAU CAC GCA AAA mRNA codon Asparagine Proline Tyrosine Amino Acid Histidinearrow_forwardTo create a DNA:RNA hybrid from a short stretch of DNA with the sequence 5'-GGCTAAGTATGCCTAGTAGC-3', design the corresponding RNA sequence. Indicate the sequence in a 5' to 3' manner. What type of helix (A, B or Z) will this double-stranded nucleic acid form?arrow_forwardConsider the following in light of the concept of levels of structure (primary, secondary, tertiary, quaternary) as defined for proteins. (a) What level is shown by doublestranded DNA? (b) What level is shown by tRNA? (c) What level is shown by mRNA?arrow_forward
- (a) Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5' GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’ X 5' GTCCCATACGTAGCCGTAGGACATGTACCG 3' Y 5' CGGTACATGTCCTACGGCTACAATGCGATC 3' Z 5' TTACAGTGGACCTACGGCTACGTATGGGAC 3' I and 21arrow_forwardGive typing answer with explanation and conclusion Which of the following statements regarding the structure and function of tRNA is true? A-The codon / anticodon pairing is absolutely universal among organism. B-The charging of a tRNA does not require energy. C-There are 64 different tRNAs, one for each possible codon. D-Reading 5' to 3', the first base in the anticodon can participate in non Watson and Crick base pairing E- The 3' end of each tRNA has a unique sequence so a specific amino acid can be attached.arrow_forwardLocate as accurately as possible the listed items that are shown on the following figure. Some items are not shown. (a) 5′ end of DNA template strand; (b) 3′ end of mRNA; (c) ribosome; (d) promoter; (e) codon; (f) an amino acid; (g) DNA polymerase; (h) 5′ UTR; (i) centromere; (j) intron; (k) anticodon; (l) N terminus; (m) 5′ end of charged tRNA; (n) RNA polymerase; (o) 3′ end of uncharged tRNA; (p) a nucleotide; (q) mRNA cap; (r) peptide bond; (s) P site; (t) aminoacyl-tRNA synthetase; (u) hydrogen bond; (v) exon; (w) 5′ AUG 3′; (x) potential wobble interaction.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license