Q: 1. A newly discovered species of dung beetle has 2n = 16 chromosomes. It mates with a closely…
A: Crossing between diverse species or populations can result in hybridization, where people with…
Q: Viruses that are enclosed by a membrane are more likely to be: a. a cause of GI discomfort b.…
A: Viruses enclosed by a membrane, also known as enveloped viruses, are more likely to cause lower…
Q: Before humans began altering the natural world. The number of species on earth remain stable through…
A: The question is asking whether the number of species on Earth remained constant before human…
Q: mbing fiber depolarizes mbrane potential to en Ca2+ channels. tage-gated channel 2+ Ca²+ Release 2+…
A: The objective of the question is to identify the most direct mechanism causing the postsynaptic…
Q: In microbial genetics, we learned about transformation as a way of genetic exchange in bacteria. a).…
A: To define transformation in microbial genetics and analyse the physical foundations of…
Q: Class garticipation Q#3 What is the relationship between the two structures of…
A: The objective of the question is to understand the relationship between the two structures of…
Q: Which Mesopotamian deity (worshipped principally on Thursday) took the tablets of destiny away from…
A: The question is asking about a specific event in Mesopotamian mythology. The Mesopotamian deity who…
Q: Population growth model Notes pulation growth ng discrete time steps, which is easier to describe…
A: By putting the given values in the population growth question we can find are estimate of how much…
Q: You are growing yeast cells in your lab. The Yeast Growth Medium contains 56 mM glucose (Mol. Weight…
A: Yeast growth medium, also referred to as yeast culture medium or yeast nutrient medium, is a…
Q: In the autonomic nervous system, the lower motor neurons directly innervate effector organs.…
A: The correct statement is:The lower motor neurons directly innervate effector organs.
Q: Kingdom Plantae is characterized by which of the following features? glycerol-1-phosphate lipids,…
A: The objective of the question is to identify the correct set of features that characterize the…
Q: Which of the following zodiac symbols is represented by the 4th tablet in the Epic of Gilgamesh…
A: each symbol may hold specific meanings and interpretations, they don't directly correspond to the…
Q: Briefly describe what will happen in each of the following situations. Assume that sucrose…
A: Sucrose molecules are too large to pass through a cellophane Bag, This sets up the conditions for…
Q: Alpha Beta chain chain CHO CHO Disulfide bridge CHO CHO What kind of receptor is show in the figure?…
A: It is an T cell receptor Explanation:The T cell receptor (TCR) is a crucial component of the immune…
Q: Which statement is NOT true regarding how the term "theory" is used in science? A. In science, a…
A: The objective of the question is to identify the incorrect statement about the use of the term…
Q: 1. What is a "pyrogenic" preparation, and what are the common adverse effects? (Napra 3.2)
A: A "pyrogenic" preparation is a material or product that can cause fever (pyrexia) when administered…
Q: Consider one type of ionizing radiation from medical equipment or a home (radon)...or even the…
A: Environmental health implications refer to the effects that environmental factors, such as…
Q: increase n sin 0 d) a & b 40) The light "bends" because: a) The light loses speed when going from…
A: Note: as multiple questions have been posted and the student has asked to solve only 40 and 41, so…
Q: Class garticipation Q#3 What is the relationship between the two structures of…
A: The objective of the question is to understand the relationship between the two structures of…
Q: Which of the following animals may have been the second pet domesticated by humans, in Egypt or in…
A: Domestication means it is the process of adapting wild animals for human use. It is a mutualistic…
Q: To create a survivorship curve for the Andean condor: Graph Title: Survivorship Curve for Andean…
A: The objective of the question is to create a survivorship curve for the Andean condor. A…
Q: How does exchange transfusion treat HDN?
A: The objective of this question is to understand how exchange transfusion is used as a treatment…
Q: A medical student is studying a liver biopsy taken from a regenerating liver following a partial…
A: The objective of the question is to identify the correct description of the chromosomes in a…
Q: PCR Review: How are you able to target specific genes in PCR? What were some possible sources of…
A: DNA is a double stranded molecule. DNA is situated in the nucleus. DNA is composed of nitrogenous…
Q: Class garticipation Q#3 What is the relationship between the two structures of…
A: The objective of this question is to understand the relationship between the two structures of…
Q: The following table depicts characteristics of five prokaryotic species (1-5). Use the information…
A: Identify non-heterotrophic bacteria species using table features.
Q: According to Greek mythology, which race was created by the Olympian gods, lived with their mothers…
A: The question is asking about a specific race in Greek mythology that was created by the Olympian…
Q: Perform data analysis for: Tiger Find the "r" value for tiger. Enter the "r" numerical value in the…
A: Tiger is in endangered species. Endangered species means that it is endangered of being extinct as…
Q: a. in a population with allele frequencies that are p=0.44 and q=0.54. How many homozygous recessive…
A: Ans. a To determine the expected number of homozygous recessive individuals in a population, we can…
Q: 20- Which organelle contains digestive enzymes and is involved in breaking down cellular waste and…
A: Cells are considered the elementary components of all living organisms. Some organisms contain a…
Q: Which of the following animals may have been the second pet domesticated by humans, in Egypt or in…
A: The objective of the question is to identify the second animal that was domesticated by humans,…
Q: #7
A: Evidence for Homo species, such as Neanderthals and Denisovans, as well as anatomical modern humans,…
Q: Describe the secondary structure that DNA might form in an ancient, dehydrated tissue sample and…
A: The objective of the question is to understand the secondary structure that DNA might form in an…
Q: Vervet monkeys in the wild exhibit which of the following scientific skills? responding to a leopard…
A: The question is asking about the specific behaviors exhibited by vervet monkeys in response to…
Q: Which river valley would become the first Sumerian agricultural site in the Neolithic period? the…
A: The objective of the question is to identify the river valley that became the first agricultural…
Q: Lipids are composed of one or more long chains of amino acids. True or false?
A: The objective of the question is to determine whether the statement 'Lipids are composed of one or…
Q: Socrates is properly credited with making which of the following statements about ethics? “the…
A: The question is asking us to identify which of the provided statements is attributed to the…
Q: A в
A: Amphioxus also known as Lancelets belongs to sub-phylum Cephalochordata. It consists of around 30-35…
Q: Blood plasma flows with a rate of 0.4 cm³/s through a tube with a diameter d = 0.18 cm and length I…
A: Solution for Maintaining Flow Rate and Pressure at ExitWe can solve this problem by considering two…
Q: Which of the following is the correct sequence of blood flow in mammals? 1 2 3 4 pulmonary artery ⠀⠀…
A: Hi student. I hope this helps you. The correct sequence of blood flow in mammals is as follows:Vena…
Q: Is the following case study an r-strategists or a K-strategists? Andean condors reach sexual…
A: The objective of the question is to determine whether the Andean condors are r-strategists or…
Q: What is a benefit of uniform dispersion? decreased competition…
A: Uniform dispersion, also known as uniform distribution, refers to a pattern of distribution where…
Q: A 29-year-old man with reactive airway disease undergoes endobronchial biopsy. The biopsy material…
A: The objective of the question is to identify the type of cell that is most likely depicted in an…
Q: When a single recombination event occurs between a normal chromosome and a chromosome with a…
A: A paracentric inversion is a type of chromosomal rearrangement where a segment of a chromosome is…
Q: A 52-year-old woman presents with a localized swelling and purulent abscess in her right hand and…
A: An abscess is a collection of pus in any part of the body. Abscesses can form almost anywhere on…
Q: Question 1: The overall process enabled by the glyoxylate cycle is: (2acetyl-CoA) + (NAD+) + (2H2O)…
A: In the glyoxylate cycle, acetyl Coenzyme A enzyme condenses with oxalic acid to form citrate…
Q: Calculate the spacing between wheat plants (inter row spacing) in a field planted on 7.5 rows at a…
A: We must first determine the total number of plants in the field and divide that number by the number…
Q: An unaffected woman for a human disorder marries and unaffected man and they have children. This…
A: Unaffected Unaffected │ │ ┌─┴───────────┴─┐…
Q: Parmenides of Elea, who argued that our perceptions of change are illusions, but logical truths are…
A: The question is asking about the metaphysical viewpoint of Parmenides of Elea, a pre-Socratic…
Q: Population growth model Notes Population growth Using discrete time steps, which is easier to…
A: By putting the given values in the equation above we can find are estimate of how much the…
With the technique of interrupted mating four Hfr strains were tested for the sequence in which they transmitted a number of different genes to an F strain. Each Hfr strain was found to transmit its genes is a unique sequence, as shown in the accompanying table. What is the gene sequence in the original strain from which these Hfr strains were derived?
![Order of transmission
First
Last
1
MUDA
K
C
R
B
L
E
Hfr strain
2
3
D
L
M
E
K
C
U
R
D
M
MOD
K
с
4
M
D
E
L
BRU
BU U](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2F277d8e9e-796c-4923-a9a2-4c05d5ad95df%2Fc222eaa5-1a10-414c-8f52-fb3360949952%2Fjox6obs_processed.png&w=3840&q=75)
![](/static/compass_v2/shared-icons/check-mark.png)
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- 0lWhatis NAD yecycleScX O 2020/ X Chapt O Pla + x ti Grades x - Micros x Attach x 2 Edpuz x (1) Dia x A quizizz.com/join/game/U2FsdGVkX19u5PV2q0828jgMm6BEgGF6fEPUbfvRFnusX%252BvbgoJX50wVADbL6X.. Johnson - Bo.. A Classes Course stream ti Planner - ProgressB. Holt McDougal Onli. G snake - Google Sear. O YouTube C 2KMTCentral | NBA A Actively Learn 1/7 Streak Whose research suggested that DNA was helical? Chargaff Watson Crick Franklin5’- TTGACATGCG ATGTCGTAGG GATATATAAT CCACACAGTC GACAATTGAC ATCCCGGTCA CCTATAATCG TGAACACATA TAAGGAGTCT GACTATGGTA AGTAAATATG GTCATTAGTT ATGTGAACAG CCATTGGAGT CCACACTGAC TGAGATTAAG AGATGCCGAT AAAGTGGATA GCATTTTAAC TTGACAATGG ACGATCGATC GTAATTACCA ATGTGAATCG TAGTTGCGCA TTTCGGACGT -3’ a) Counting from the first nucleotide (A) of the Shine-Dalgarno consensus sequence, show the sequence of the first 20 nucleotides in the mRNA encoded by this piece of DNA (specify 5’ & 3’ ends). b) What is the sequence of protein X (specify the amino and carboxyl termini)? c)A mutation occurs in the original DNA strand for protein X such that the adenosine nucleotide at position +35 is deleted. What is the effect of this mutation? d) A mutation occurs such in the original DNA for protein X strand such that the adenosine nucleotide at position +48 is changed to a thymine. What is the effect of this mutation?
- * Le TH Sa u GWG AA PE x GWB Bi 31 K S. .com/forms/d/e/1FAlpQLSeRQOhizlj9haFIAG8XZwqYqNjd4lzDAumrUT8-Azr5lcf77g/viewform?hr_ submission=Chkl14ORirMBEhA e A 33rd Period 10th Gr... Maps H Mail - SC458917 -.. A 33rd Period 10th Gr.. E Applied Educationa.. A To-do A researcher uses a logistic model of population growth. Which statement best describes the relationship between time and population size in a logistic growth model? Over time, population size increases without limit. Over time, population size increases and then levels off to a maximum value. Over time, population size decreases and then levels off to a minimum value. Population size is not related to the passage of time. As limiting factors, how do disease differ from a forest fires? thing 1O DELLSecond letter UGU UGCCYS UCU UAU UAC Tyr UAA Stop UGA Stop A UAG Stop UGG Trp UUU Phe UUC. UCC Ser UCA UUA Leu UUG S UCG CAU CUU CUC Leu CỦA CGU CCU CC ССА CCG His CAC CGC Pro Arg CAA CGA Gln CUG CAG CGG AGU AGC AGA AAU ACU ACC ACA AUU Ser AUC File A AUA Asn AAC. AAA AAG Thr Lys AUG Met ACG AGG Arg GCU GCC GCA GCG GGU) GGC Gly GUU GUC Val G GUA GAU) Asp GAC Ala GAA Glu GAGJ GGA GUG GGG A mutation takes place during replication and the new DNA strand has the sequence 3'-ATG-5'. What is the codon on an RNA strand transcribed from this series of nucleotides? Which amino acid results from this codon? Use the genetic code to answer this question. Edit View Insert Format Tools Table 12pt Paragraph Av ev T? MacBook Pro 20 00 000 23 $ % & 7 First letter Third letter * OC 全AGTGCAGCTC CAGCCGACCC CCGGGACGTA GACAAGGGCA GGCGCGCGGT 50 GAAGACTGCG GCCGGCCGCG TAGCCGCGCT GTGGTCCCGC TGGCCTTCTC 100 TTGGGCCGCG CACCCTCCGG ACCTGCGTCG GGATCCTCCC GGAGTCTCCC 150 GCTCTCTCCT CCCGGCTTGC GAACATGCGG CCCCTTAAGC CCGGCGCCCC 200 TTTGCCCGCA CTCTTCCTGC TGGCGCTGGC TTTGTCCCCG CACGGAGCCC 250 ACGGGAGGCC CCGGGGGCGC AGGGGAGCGC GCGTCACGGA TAAGGAGCCC 300 AAGCCGTTGC TTTTCCTCCC CGCGGCCGGG GCCGGCCGGA CTCCCAGCGG 350 CTCCCGGAGC GCAGAAATAT TCCCAAGAGA CTCTAACTTA AAAGACAAAT 400 TCATAAAGCA TTTCACAGGG CCGGTCACAT TTTCACCAGA ATGCAGCAAA 450 CATTTCCACC GACTCTATTA CAATACCAGG GAGTGCTCAA CGCCAGCTTA 500 TTACAAAAGA TGTGCTAGAT TGTTAACAAG ATTAGCAGTG AGTCCACTGT 550 GCTCCCAGAC CTAGCAAAAC TACCCTACAT TTCCTAAGAA TGTACATCTA 600 ATTTGAAGAA AAAGTGCCTC AAATCATGCA AAATGTAAAA AAAGATGAAA 650 TTTATATTTT TATGGATATT AAGATGAGTA AAATAAGAGA CTTCCCAGAA 700 ATAACTGGTT AGCTGTTTCC TGTCATAGAA TGGAGTCTTT CTTGCTTTAT 750 CTTTTTGTGT ATACAGTAAT TTATAATTTT GTAAAACAGA GTTTGAATCG 800 CATATTGAAA ATTAGATATT AAAAATTGTG…
- Second letter UUU UUC UUA UUG. UCU UCC UCA UCG UAU Tyr UAC. Ser UAA Skp UGIA Stop UGU UGC. Phe Cys Leu UAG Sop UGG Trp CGU CGC Arg CGA CCU CAU CUU CUC CUA CUG His CAC CAA CAG Gin CCC Pro CCA Leu CCG CGG ACU AAUA AGU ]Ser AUU Asn AAC AGC AGA LArg AGG. AUC Be ACC ACA Thr AAA AUA AUG Met ACG MGys GUU GUC Val GUA GCU GCC GCA GCG Ala GAA Glu GAG GAU GAC Asp GGU GGC Gly GGA GGG GUG You come across four polynucleotide strands. The first is an original RNA strand that codes for a protein; the others are similar to the original RNA strand, except that each displays a point mutation. The point mutations are shown in red. 5' - AUG-UGC-AUU-CCU-GCA-UAA - 3' 5' - AUG-UGA-AUU-CCU-GCA-UAA - 3' 5' - AUG-UGC-AUU-CCC-GCA-UAA - 3' 5' - AUG-UGC-GUU-CCU-GCA-UAA - 3' Original RNA: Mutant RNA 1: Mutant RNA 2: Mutant RNA 3: 1. Based on how they will affect the protein product, identify the type of point mutation (missense, nonsense, silent, or frameshift) present in the Mutants 1, 2, and 3. 2. State which of…1 10 20 30 40 50 60 70 -I---- 5' АTCGGTCТCGGCTACTACАТАAАСGCGCGCATATATCGAТАТСТАGСТАGСТАТCGGTCTAGGCTACTАC 3' TAGCCAGAGCCGATGATGTATTTGCGCGCGTATATAGCTATAGATCGATCGATAGCCAGATCCGATGATG I--------I--- --I--- --I------ --I--- -I---------I Promoter 80 90 100 110 120 130 140 -I---- 5' CAGGTATсGGTCTGATCTAССТAGCTTCTтсттстстстстсссссGCGGGGGCTGTACTATСATGCGTCG 3' GTCCATAGCCAGACTAGATCGATCGAAGAGAAGAGAGAGAGGGGGCGCCCCCGACATGATAGTACGCAGC -I- -I------- -I--- -I---------I RBS 150 160 170 180 190 200 210 -----I--- ---I-- ------I- ---I---------I---- -I---------I 5' тстCGGCTАСТАCGTAAACGCGCGCATATAтCGATATCTAGCТAGСТАТСGGTстCGGCTACTAсGTAAA 3' AGAGCCGATGATGCATTTGCGCGCGTATATAGCTATAGATCGATCGATAGCCAGAGCCGATGATGCATTT 220 230 240 250 --I----- ---I-- ------I--- -I 5' CCCTATTAGCATGGGTCATATTTGTGTCTGCTTGTTGGGT 3' GGGATAATCGTACCCAGTAGAAACACAGACGAAGAACCCA a. What are the nucleotides of the MRNA from gene Z? b. What are the amino acids encoded by gene Z? ( Vate VPlz don't plagarism-answer
- HindII --- 5' GTC - GAC 3', HaeIII --- 5' CC - GG 3', EcoRI --- 5' G - AATTC 3' and BamI --- 5' CCTAG - G 3' 5' AGAATTCTTACGCCGGACGTACCTAGGTTTAGTCGACTC CGCCGCCCCTAGGGTCATCA 3' 3' TCTTAAGAATGCGGCCTGCATGGATCCAAATCAGCTGAGGCGGCGGGGATCCCAGTAGT 5' Number of pieces of DNA , and blunt end fragment (s), and sticky end fragment(s)Second letter C UUU UGU UGC. UUC Phe UUA UUG UCU UCC UCA UCGJ UAU1 UAC. Ser UAA Stop UGA Stop A Tyr Leu UAG Stop UGG Trp CAUTHIS CACS CAA GIn CAG CGU CGC Arg CCU CUU CỤC CỦA CUG J CC Leu Pro ССА CGA CCGJ CGGJ AGU Ser ACU АСС ACA AUU AAU Asn AAC AAA AUC le AGA TArg Thr AUA AUG Met ACG AAGLYS AGG GAU GUU) GUC GUA GUG GCU) GCC GCA GACASP GAA AGlu GAGS GGU GGC Gly Val Ala GGA GGG GCGJ Given the following mRNA sequence: 5' GCCCAUGUGGCGCGAGUGAUUUAA 3' Third letter UCAC UCAG UCAG UCAG 등 | First letterC A UUU U UUC Phe UCU UCC UCA UAU UAC UAA UAG UGU Cys U UGC Stop UGA Stop Stop UGG Trp G Tyr Ser UUA UUG Leu UCG CUU C CUC CUA CCU Leu ccc CCA CCG CAU CAC CAA His CGU CGC CGA CGG Pro Arg 1st Gin CUG CAG 3rd letter AUU A AUC AUA AUG ACU AAU AAC Ser u letter C Asn AGU AGC AGA AGG lle ACC Thr ACA AAA AAG Lys Arg Met ACG GUU G GUC GUA GUG GCU GCC GCA GCG GAU GAC GAA GAG Asp GGU GGC GGA GGG Val Ala Gly Glu Not all of the following ingredients are necessary for an in vitro translation reaction. Which one would you leave out? A ssDNA template O Cell sap containing ribosomes poly(U) O 14C-Phe