on ni alluzen en 200B. Gene A contains a base substitution that results in a nonsense mutation.HiW Sesqar to (lis 10) VasAnton lo posupse onWill this mutation change the sequence of protein A produced in any of the three cell types ? ilWill this mutations change the levels of RNA or protein (# of molecules) produced from gene A?In a specific cell type? Briefly explain your answer.IiW Saqi Iso 991 od to (lis 10) vs ni 8 istory to coupe gredo noitatum eids HiWC. Gene B contains a mutation in cis reglatory sequence Z (Z is non-functional). do anoitesum airbTowans woy nislqxs vfton Seqvi lloo oftiosqeWill this mutation change the sequence of protein B in any of the three cell types? Will thismutations change the levels of RNA or protein (# of molecules) produced from gene B? In aspecific cell type? Briefly explain your answer. BongQuestion #1: The diagram below depicts the regulatory regions for two (made-up) genes, whichcontain cis-regulatory sequences X, Y, and Z and bind to transcriptional regulatory proteins:zeloled diogot bolgateSMARTY – a transcriptional ACTIVATOR protein, which is present in all neuronal cells andbinds to cis-regulatory sequence, X1oq & vino 19vewod.152 moldong sai mut tumBRAWNY-a transcriptional ACTIVATOR protein, which is present in all muscle cells andbinds to cis-resgulatory sequence, Yolgulum di ko malo naSNARKY - a transcriptional REPRESSOR protein, which is present in peripheral neurons onlyand binds to cis-regulatory sequence Z100bio se i da selotimo broup gniwollt od 19bolgate ons zegg or we de base do no me to stir noitesup od went ofsistemos seu anoitesup 15wens horle 10oldog woy ni gnius stoted 1910 ni tatayotovizasovo got no rade od lliw anioq azia oo ingene Aroom or bXyJeol VELY gan 100 TonnodigeΤΑΤΑ,229nibrowdongH .aodto diw atse meldong mov.no o (ne si bas) y OYmollitw od bivore te moldorq woY chow woonheid indie moldog si mun jaurIlive 2192 mela Xeldogene Bebi ovn 1200W VWO яUOY MIover moralshetem 1910 10 2198 mld en ton yem DOY"0" to obsig ansvig denobesup vas sved woy 1.noitsloiv virgatni simobeos no borobianos od lliw o no ba ydind ai had916 TATAZ

Name: on ni alluzen en 200B. Gene A contains a base substitution that resul
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: on ni alluzen en 200B. Gene A contains a base substitution that results in a nonsense mutation.HiW Sesqar to (lis 10) VasAnton lo posupse onWill this mutation change the sequence of protein A produced in any of the three cell types ? ilWill this mut

A non sense mutation is the one where a codon is converted to stop codon and there is premature…

Science

Biology

on ni aliuzen en B. Gene A contains a base substitution that results in a nonsense mutation. HTW Sesqut so sordi ar to (lls 10) vns ni A nision to ponous Will this mutation change the sequence of protein A produced in any of the three cell types ? i Will this mutations change the levels of RNA or protein (# of molecules) produced from gene A? In a specific cell type? Briefly explain your answer. W Sasqi Hoo soto (10) y mi a miston lo sonsupez si sgredo noitstum eid W C. Gene B contains a mutation in cis reglatory sequence Z (Z is non-functional).o anoitstumaidi towans woy nisiqxs vftsina Segy loo oftiosqe Will this mutation change the sequence of protein B in any of the three cell types? Will this mutations change the levels of RNA or protein (# of molecules) produced from gene B? In a specific cell type? Briefly explain your answer.

on ni aliuzen en B. Gene A contains a base substitution that results in a nonsense mutation. HTW Sesqut so sordi ar to (lls 10) vns ni A nision to ponous Will this mutation change the sequence of protein A produced in any of the three cell types ? i Will this mutations change the levels of RNA or protein (# of molecules) produced from gene A? In a specific cell type? Briefly explain your answer. W Sasqi Hoo soto (10) y mi a miston lo sonsupez si sgredo noitstum eid W C. Gene B contains a mutation in cis reglatory sequence Z (Z is non-functional).o anoitstumaidi towans woy nisiqxs vftsina Segy loo oftiosqe Will this mutation change the sequence of protein B in any of the three cell types? Will this mutations change the levels of RNA or protein (# of molecules) produced from gene B? In a specific cell type? Briefly explain your answer.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 10TYK: A part of an mRNA molecule with the sequence 5-UGC GCA-3 is being translated by a ribosome. The...

See similar textbooks

Similar questions

E VG ✓H NA MATEN Match each letter (A through G) to its description. B A ya pada saat ada para a H F காலிமாம்ம் P S —— 1. Receptor 2. RNA 3. Lysosome 4. DNA 5. Ribosome 6. Ligand 7. Kinase domain 8. Nucleus 9. Mitochondria 10. Phosphorylated transcription factor 11. Dephosphorylated transcription factor 12. Plasma membrane
Create a metabolism cocept map using these terms RepressorInducer RiboswitchRepression InductionPositive regulationActivatorOperator Heat shocklac operontrp operon Catabolite RepressionHeat shocksigma-32 Negative regulationTwo-component regulationSensor Kinase Autoinducing Peptide (AIP)Response regulatorSigma factorsFeedback inhibitionProtein StabilityQuorum SensingRNA regulationAntisense RNAHomoserine Lactone (AHL)
rces co NOV 14 F2 # 3 Draw a linear regulatory pathway that describes this portion of the metaphase/anaphase transition pathway. Include anaphase, APC, cohesin, securin, and separase connected with activation/inhibition arrows as appropriate. ㅁㅁ 13 mitotic spindle active APC/C S4 cohesin complex 000 000 F4 inhibitory protein (securin) inactive proteolytic enzyme (separase) ci so active separase 54 metaphase O F5 1 6 165/20 attv /www Į .... A F6 MacBook Air UBIQUITYLATION AND DEGRADATION OF SECURIN & 7 cleaved and dissociated cohesins anaphase L F7 8 11 F8 ►►► 9 F9 0 FIC
Name: Clas: Date: Transcription 3" ATGACGGATCAGCCGCAAGOCGGAAfTGGCGACATAA UACUGCCUAGUCGGCGUU 3 5' WA WAW TACTGCCTAGTCGGCG TCGCCTTAACCGCTGTATT 3' 6 Label the diagram as you read the following passage. Transcription is the process cells use to copy information from DNA into messenger RNA copies. Part of the chromosome's tightly wound-up long strand of DNA is "loosened" to allow for RNA polymerase room to copy part of the DNA. Think of this as opening a page out of a giant book with thousands of pages to make a copy of just that one page. One side of the DNA strand is the template strand (or anti-sense strand) and is used by an enzyme called RNA Polymerase to create the messenger RNA. RNA Polymerase is directed by a bunch of proteins called transcription factors to the spot it needs to start copying. RNA Polymerase reads the template strand from the 3' end to the 5' end and creates a messenger RNA strand that is complementary to the template strand. In the diagram above, you can see that…
AKS 5c1: Which explanation accurately describes the model below? * DNA MRNA Transcription Mature MRNA Nucleus Transport to cytoplasm for protein synthesis (ranstation MANA Cell membrane This model represents protein synthesis since the tRNA is delivering amino acids to form a polypeptide chain that will form a protein. This model represents protein synthesis since the tRNA is delivering lipids which will be used to bond proteins to form an enzyme. This model represents protein synthesis because DNA is being copied during transcription in the nucleus before leaving the nucleus. This model represents protein synthesis because MRNA is coiling to form a new protein molecule in the cytoplasm.
RNA polymerase O Transcription to produce pre-mRNA O Post- transcriptional modification Nuclear pore complex OExport of mature mRNA into cytoplasm OPost- Ribosome with transfer RNAS translational O Translation of OProtein folding modifications. mature mRNA Look at the image above: 3. Where does transcription specifically take place in the cell? 4. Where does translation specifically take place in the cell?
A single mutation in one of the transcription factors inProblem 33 results in a drastic reduction in YFG transcription. Diagram what this mutant interaction mightlook like
You study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 ТТCGAGCTCTСGTCGTCGAGATACGCGATGATATTАСТGGТААТАТСGGGАTGCАСТАТС 3' 5' AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATAÇECCTACGTGATAG ΤΑTC promoter RNA polymerase Practice Question 4 C) What are the first 5 amino acids encoded by this gene? N' C' ribosome
BONUS: In Bacteria, recognizes the Ribosomal Binding site on mRNA and catalyzes formation of peptide bonds during translation (answers must be in correct order) O aminoacyl tRNAses; aminoacyl TRNA synthetases ribosomal protein translation factors; ribosomal protein initiation factors O helicase; gyrase O 165 rRNA; 23S rRNA
You study the expression of the hexose kinase gene and capture the following electron micrograph of the gene being expressed. MRNA 1 20 ORI 40 60 TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAA! AAGCTCGAGAGCAGCAGCTСТАTGCGCTAСТАТААТGACСАТТАТАССССТАСGTGATAG 3' СTGGIAATATOGGGATGCACTАТС 5' RNA promoter polymerase Practice Question 4 F) You also study the expression of different mutants for this gene. Mutant B has a 2 G/C pairs inserted between position 19 and 20 (position denoted by the ^ in the sequence above). For mutant B answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 3'...TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC...5' 5'..AAGCTCGAGAGCAGCAGCTCTATGCGCTACTATAATGACCATTATACCCCTACGTGATAG...3' promoter m in…
Which of the following small GTP-binding proteins does NOT play a role in cell migration during chemotaxis? O Cap Z Rho Cdc42 O All of the listed GTPases play a role in cell migration O Rac ◆ Previous
| What is translational repression? Explain why do cells use translational regulation to respond to signal cues like heat shock in the environment ? NUCLEUS CYTOSOL RNA transport translation control protein activity control control RNA transcript mRNA 1 3 MRNA. inactive protein DNA. -protein. transcriptional control RNA nuclear pore processing control nuclear envelope