If a sequence of bases on a DNA molecule is GATTACA, what would complimentary MRNA strand look like? * CTAATGT CUAAUGU GATTACA TGCCGTC

Q: A Section of a Gene CTA AAA TAG TCT For the DNA sequence shown above, identify the following: mRNA…

A: A biological process in which the information present in DNA is copied to RNA (mRNA) is known as…

Q: Compare the two DNA sequences shown below and consider the single nucleotide mutation made in the…

A: Quality transformations include adjustment in the construction of qualities which changes or alters…

Q: The following is a strand of mRNA: CAA GUG AAA ACA How many amino acids does the mRNA strand above…

A: The protein synthesis process requires the genetic material in the form of DNA to be transcribed…

Q: DNA MRNA Amino Acid

A: It is on the basis of centra Dogma of molecular Biology. central dogma is the process by which DNA…

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:

A: This question is based on the functioning of mRNA expression.

Q: DNA Sense G C A strand DNA Antisense TAC T strand AUG MRNA codon U TRNA anticodon Amino acid…

A: Transcription Cellular process in which RNA is synthesized using DNA as a template known as…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: The sequence of part of an mRNA transcript is What is the sequence of the DNA coding strand? 5'- 5'…

A: DNA is double stranded & during replication both of its strands unwind to produce single…

Q: The base sequence of one DNA strand is given. Use base pairing rules to give the other DNA strand.…

A: The base pairing rules are: G is replaced by C C is replaced by G A is replaced by T and T is…

Q: Use the table of the codons to answer the following question. Starting with the start codon, what is…

A: A codon is a sequence of three consecutive nucleotides in a DNA or RNA molecule that codes for a…

Q: Place sequences a, b and c into the correct order based on start and stop codons. Sequence A…

A: Introduction  Codons are units of genomic information made up of three nucleotides (trinucleotides)…

Q: DNA            A G T A C C G G G C A A A C T G C A T T G T G            mRNA U C A U G G C C C G U…

A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…

Q: Separate the following strand into codons: AUGGAACCGUAU Your answer

A: Each codon is made up of three nucleotides, each of which corresponds to a single amino acid. The…

Q: Identify which regions of DNA encode the protein sequence. Consider that there may be introns (which…

A: Transcription is a process through which the template DNA strand is transcribed into mRNA. mRNA…

Q: If a sequence of bases on a DNA molecule is GATTACA, what would the complimentary mRNA strand look…

A: DNA replication is the process of the formation of identical copies of DNA.It occurs in nucleus.…

Q: Explain in one statement/phrase why the base sequence ATC could not be a codon.

A: As per the central dogma of molecular biology, genetic information flows from DNA →RNA →Protein.…

Q: Using the base pairing rules which three rna bases pair with the following dna codon TAC

A: The two nucleic acids, DNA and RNA, present in the cell are polymers made up of nucleotides. These…

Q: A particular triplet of bases in the template strand of DNA is 5' AGT 3: The corresponding codon for…

A: Transcription is a heterocatalytic action of DNA by means of which RNA is synthesized from specific…

Q: A template strand of a gene contains the sequence 3’ – TTCAGTCGT – 5’. Suppose that the nontemplate…

A: Given: A template strand of a gene contains the sequence 3’ – TTCAGTCGT – 5’.

Q: The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to…

A: Replication is the process of the formation of identical copies of DNA. It takes place in the…

Q: If the DNA strand has nitrogenous base sequence ATTGCC, the mRNA will have?

A: The transcription is a process of conversion of DNA to mRNA using RNA polymerase enzymes which…

Q: The following sequence is the coding strand of a piece of DNA. Type out the corresponding template…

A: The protein sequence can be decoded by a coding or template DNA given. The mRNA strand is the same…

Q: Below is the sequence of an mRNA that has just been transcribed. Please translate this sequence as…

A: Let's rearrange the mRNA in the codes of three.  ACG UCC AAU GGC AGU GAU UUG AAU CCA ACG codes for…

Q: Using the genetic code, interpret the following set of nucleotides.…

A: The genetic code is a set of rules that living cells use to convert information found in genetic…

Q: D In the following DNA strand, find the position of the start codon, stop codon and determine the…

A: The given DNA strand - GGTACTTTATACCCTGATACATTTGTGGGG Corresponding mRNA strand -…

Q: 1. What is the first codon in the mRNA strand? 2. The second codon in the DNA double helix is TAT…

A: The DNA (deoxyribonucleic acid) that forms the genetic material of an individual contains…

Q: Using a codon table, complete the DNA triplets, mRNA codons, tRNA anticodons, and amino acids in the…

A: Genetic code is in triplets and the codes are read by the anticodon and thus the amino acids are…

Q: Which reading frame gives you the longest amino acid sequence? 5'3 Frame 1 5'3 Frame 2 5'3 Frame…

A: In the world of molecular biology, understanding reading frames is crucial for deciphering genetic…

Q: Compare the two DNA sequences shown below and consider the single nucleotide mutation made In the…

A: Gene mutations involve alteration in the structure of genes which alters or modifies the structure…

Q: Using the codon chart, if the DNA strand being described is AGG TCT GAT , the resulting amino acid…

A: The order in which amino acids are found in a protein. Proteins are made up of 20 different types of…

Q: Using the provided čoding strand below 5-ATCAGATGGCCGGGCCAATAGAATAGCTGT-3 Provide the anticodons…

A: DNA is two stranded ladder like structure which comprises of :-  A) Coding strand  B) Template…

Q: A mistake during DNA replication leads to a mutation in the nucleotide sequence shown below. DNA DNA…

A: Mutations are a genetic phenomenon in which alterations in the sequence of nucleotides of DNA occur.…

Q: A scientist while sequencing mrna identifies the following strand…

A: Translation is the process by which polypeptides are synthesized from a mRNA transcript which is…

Q: Given the following sequence of nucleotides of a template DNA strand, predict the sequence of mRNA…

A: The DNA nucleotide sequence given above is- 3' CGTACGCCGAGACGTCAAC 5' (Template DNA strand) The mRNA…

Q: following is a series of DNA triplets. first, transcribe the correct complementary sequence of mRNA…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: A Section of a Gene TGC GTG TAC CTA CCA For the DNA sequence shown above, identify the following:…

A: The given DNA sequence is as follows,  TGC GTG TAC CTA CCA

Q: If the DNA has a triplet code of CAG in one strand (the strand used as a template for transcription)…

A: DNA and RNA are are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.