If DNA segments changes from GCATAG to GCATA, this is a:

Q: Fill in the blanks in the selection below. Use the video to help you. A DNA molecule is made up of a…

A: The process by which the parental characters are inherited from the offsprings is known as…

Q: True or false Oncogenes are gene that are normally not found in a cell and must be introduced into…

A: Cancer is a group of diseases involving abnormal cell growth with the potential to invade or spread…

Q: What does the chipko andolan resulted to?

A: Chipko movement is also known as Chipko Andolan. It was launched to conserve forest in India. It was…

Q: Below is a primary sequence alignment between the wild-type hemoglobin protein, and the hemoglobin…

A: Hemoglobin can be described as a pigmented protein that forms a component of the red blood cells or…

Q: This is a paper centrifuge: (you don't need to watch the whole video, just a few seconds to see how…

A: Centrifugal force is based on density gradient  In a centrifuge the densest object settle at the…

Q: e 0---H-N CH2 N-H---N d 0--H-N CH, N-H---N N-H---0 CH2 j N-H---O CH2 N---H-N }. CH, N-H-0 N---H-N…

A: --->This is the DNA sequence and it is made of A POLYMER of NUCLEOTIDES. A nucleotide consists of…

Q: Hemoglobin, a protein found in red blood cells, carries oxygen. Abnormal hemoglobin cannot carry as…

A: Part A:Messenger RNA sequences produced from the normal and abnormal DNA sequences:Normal DNA…

Q: HindII --- 5' GTC - GAC 3', HaeIII --- 5' CC - GG 3', EcoRI --- 5' G - AATTC 3' and BamI --- 5'…

A: Restriction enzyme varies from one other in their restriction sites as well as the type of ends they…

Q: false: in humans, genes make up more than 50% of the genome.

A: Most genomes, including the human genome and those of all other cellular life forms, are made of DNA

Q: Describe the function and molecular structure of a telomere.

A: All cellular systems are controlled by proteins. Proteins are synthesized by the cell by a process…

Q: Identify the structure indicated by the Yellow arrow.

A: The human body is a well built machine in which all the organs coordinate together to make it work.…

Q: Chromosomal ____________include those that removeor add base pairs (deletions and duplications), and…

A: Chromosome is a thread like structure containing a part or all of the genetic material of an…

Q: In a numeric pyramid,is it possible the base to be smaller than the other levels?

A: A pyramid of numbers or numeric pyramid shows the total number of individual organisms at each level…

Q: Using a diagram, and 3-5 sentences, explain the relationship between cell immortality and telomerase…

A: Each time a cell divides, the telomeres get shorter. Telomeres are a region of repetitive nucleotide…

Q: Below is a picture of DNA fingerprints of eight members of thể Khlght family. Individuals 4, 6, and…

A: DNA fingerprinting is a laboratory technique used to establish a link between biological evidence…

Q: Sickle-Cell Anemia is one disease that arises from a known point mutation in a protein.  This…

A: Sickle cell anemia is a genetic disease. This disease is especially common for Africans.

Q: Ultraviolet light causes thymine dimers to form in DNA. Some individuals are genetically incapable…

A: Genetic variation is very important for evolution, but genetic stability is crucial for survival…

Q: ckle cell anemia is a hereditary disease in which a faulty hemoglobin (Hb S) molecule is produced. A…

A: Hemoglobin is an iron-containing protein present in the red blood cells (RBCs). It transports oxygen…

Q: In this gel, which letter (A, B, or C) indicates the largest piece of DNA in lane one? If the…

A: Gel Electrophoresis is a separation technique for the DNA fragments based upon their size. When the…

Q: 5'-CCGATATAATGAGTCGTCGTCTGGGCCTTCATGTATTCATGGGAAGAGAGTGTAATGTTTGCCTAAGGCC -3 70…

A: As per the central dogma of molecular biology, the genetic information stored in the DNA is copied…

Q: Please write a paragraph that compares and contrasts transformation, transduction, and conjugation…

A: Transformation, conjugation and transduction are the specialised process in bacteria or prokaryotes…

Q: Look at the amino acid chart below that the proctor placed on a board at the front of the classroom…

A: Sickle cell anemia is an inherited blood disorder that affects the structure and function of red…

Q: Write down the name of the infectious agent of COVID-19 disease.

A: Microorganisms or microbes generally are visible under the microscope only. These include living…

Q: (a) Complete the table, using a letter D, R or B, to show whether each statement applies to: DNA…

A: Genetic material is the hereditary substance in the cell. It carries all information specific to…

Q: ALL GROUPS HAVE A MUTATION MAKE SURE TO IDENTIFY THEM**

A: A mutation is a change in a DNA sequence. It can result from DNA copying errors made during cell…

Genetic Evolution

Sexual reproduction produces distinct population variations. Heredity determines the traits and qualities to be passed down to the progeny. Over time, this variation within-species is also affected by the process of human evolution. The study of how genetic variation leads to evolutionary changes is known as genetic evolution. If a trait helps an organism to survive and reproduce, it is more likely to be passed down the generations. It is rare that such traits result in a completely distinct set of traits in descendants than the ancestral population; this can result in the emergence of a new species.