OLD STRAND NEW OF DNA REPLICATION TCG ATT ACT 1 ACT AGT ACT 4 AGG ACC TAC CTG TAG 7 AGG STRAND OF mRNA TRANSCRIPTION 2 5 8 PROTEIN NAME TRANSLATION 3 6 9
Q: 12. When 2 unpalatable or harmful species mimic each other, this is called? a. Mertensian mimicry .…
A: Mimicry and warning coloration are general forms of defensive nature exhibited by organisms.…
Q: Distinguish the following phyla by its characteristics and features. Give a specific example for it:…
A: All the organisms are classified into certain kingdom, phyla, class, order, family, genus and…
Q: По Unaffected Male Unaffected Female 3 25% O 100% O 50% O 75% Affected Male Affected Female 1 5 2 6…
A: Given: A pedigree. The pedigree is for the X-linked dominant trait. The likelihood that individual…
Q: Sickle cell 1). how many people does it affect? 2) Is it genetic and if so what chromosome is the…
A: The sickel cell anemia is a genetic disease and a large amount of population is affected by this…
Q: is the achilles' tendon reflex so hard to demonstrate compared to others? Why is the blinking reflex…
A: Answer: achilles tendon reflex so hard to demonstrate because it is innervate primarily by s1 and s2…
Q: The genes responsible for albinism (A or a) and pink eyes (P or p) in mice are linked and wild-type…
A: The genes forms the hereditary units of the life. At the same time it consists of two alternative…
Q: Explain sarcopenic obesity and its effect on the elderly.
A: Obesity is described as a condition in which the body consumes too much fat. Obesity is caused by…
Q: Question- When 2 species compete for a limiting resource and one drives the other to extinction in…
A: Introduction :- The division of limited resources by species to avoid competition in an ecological…
Q: Which of the following list places the important evolutionary innovations in the correct order of…
A: ANSWER) (d) Notochord - vertebrae - jaws - bony skeleton - lobe fins - internal nares Notochord -…
Q: ou count 54 colonies of bacteria on an agarp late on which you spread 0.2ml of a 10^-4 (or 1/10,000)…
A: Given information No. of colonies= 54 Volume = 0.2 ml Dilution = 1/10000
Q: To which domain does the Philippine Eagle belong? O Eukarya O Chordata Carnivora O Animalia
A: Towards the mid 1970s, scientists began classification of living organisms according to their…
Q: Which one of the following best describes the innate nonspecific immune system? Group of answer…
A: Answer : best describes the innate nonspecific immune system is : 2. the production of antibody…
Q: The codon AUG on the mRNA codes for which amino acid (give the 3-letter abbreviation)? _______…
A: The translation is the process by which protein or polypeptide chain is produced from mRNA. The mRNA…
Q: Define Cardiac Output, give its relationship with Stroke Volume.
A: Introduction - The heart is a muscular organ the size of a fist that is placed directly behind and…
Q: Which statement is true? Statement 1: Antibodies are not specific for each type of antigen…
A: Immune cells are those cells which protect the body from the antigens. The antigens can be produced…
Q: Illustrate the stages of mitosis, as seen under HPO. Label the stages A-J.
A: Cell cycle is a series of events that takes place in a cell as it grows and divides. It has two…
Q: Do all gram negative organisms grow on EMB? A. no B. yes
A: EMB (Eosin methylene Blue) is a kind of media that is used to differentiate lactose fermenting…
Q: What are drug resistant pathogens? What are three different molecular mechanisms an organism might…
A: Drug resistance pathogens are the pathogens or microbes which have resistance to antibody or drug,…
Q: Statement 1: Fever is a sign of pathogen infection. Statement 2: Vasodilation is a type of immune…
A: *A temporary increase in average body temperature that is 37°C is called as fever *Vasodilation…
Q: Statement 1: Dendritic cells are phagocytes with professional antigen-presenting properties.…
A: Introduction Immunity refers to your body's ability to recognise pathogens and prevent diseases. The…
Q: Make a Chi square using the average calculated from the trials and interpret the results from the…
A: Humans lie or exaggerate because in some way it would benefit them. In a similar way, animals also…
Q: In humans, hemophilia is an X-linked recessive gene and will only be expressed in females if they…
A: Introduction Haemophilia or hemophilia is usually an inherited bleeding disorder that impairs the…
Q: Which of the following is not true about a gram-positive cell wall? It has plasma membrane inside…
A: Introduction :- The Gram-positive cell wall is made up of many interconnected peptidoglycan layers…
Q: After transcription has been completed in eukaryotes, the mRNA molecule first goes through some…
A: Nucleus is main controller of the cell which carries genetic instructions . It contain thread like…
Q: Who should have access to James Lanahan’s gene testing report? Please give reasoning.
A: Answer :the genticist can have the gene testing report of james lanahans if he is not in the…
Q: (i) (ii) Draw the potential tautomers of guanine. Explain the potential risk of guanine (enol form)…
A: (i)The potential tautomer of Guanine is-
Q: Describe the stages an egg goes through from fertilization to the birth of a baby.
A: Introduction Fertilization is defined as the joining of two haploid gametes, the spermatozoa and…
Q: Directions: Based on the analogy of light reactions. Describe the pattern of the electron flow…
A: The initial phase of photosynthesis is the light reaction, that converts sunlight into chemical…
Q: P generation Parent 1 Parent 2 X Using a separate piece of paper, draw out a Punnett square, and…
A: A trait is a characteristic feature that is unique to particular individual . A monohybrid cross is…
Q: B) Migration is a one-way movement. C) Because their offspring return to the ocean, the entire…
A: Salmon are considered “anadromous” which means they live in both fresh and salt water. These are…
Q: The definition of "lineage" is:
A: Lineage refers to a group of individuals that have descended from a common ancestor. They descend in…
Q: 15. Coupling Redox reactions The top reaction was left out of the table. It is: 1/2O2 + 2H+ H₂O E'o…
A: Equation ΔGo = -nFEo ΔGo = Standard Gibbs energy n= electrons transferred F = Faraday's constant…
Q: (i) Draw and explain how SPO11 can generate double strand breaks. (ii) What would be the…
A:
Q: (iii) Explain why DNA in the presence of monovalent cations will have a high melting temperature…
A: Melting temperature Tm Tm is defined as the temperature at which 50 percent of the double-stranded…
Q: The following double stranded DNA fragment was double digested with BamHI and Kpnl. If you ran the…
A: Restriction enzymes are the enzymes which cut the DNA at specific sequences. The specific sequence…
Q: Would you support the use of therapeutic cloning in order to produce ES cells for treatment of…
A: Introduction Therapeutic cloning:- It is sometimes referred to as "somatic cell nuclear transfer" or…
Q: Sickle cell 1). how many people does it affect? 2) Is it genetic and if so what chromosome is the…
A: Note :-Since you have asked a question with multiple parts im only answering the ist 3 as per…
Q: Statement 1: Major histocompatibility complex proteins help the immune system recognize 'self' vs…
A: An organism's immune system is a set of biological systems that protect it from disease. It can…
Q: What made the angiosperms the most successful terrestrial plants? Discuss your answer.
A: Answer Angiosperms are the most dominant form of plant life in most terrestrial ecosystem.
Q: Is there a type of parasitic transmission that is significantly more efficient than the other types?…
A: Types of parasitic transmission :-
Q: Illustrate how cohesin proteins form a V-shape heterodimer.
A:
Q: Assume that the TA prepared a negative control (A sample produced from a certified non-GMO food). If…
A: GMO These are genetically modified organisms that have their DNA manipulated through the techniques…
Q: The a-adrenoceptors are subdivided into two subgroups, a1 and a2, based on their response to the…
A: Adrenorecepors are also known by the name of adrenergic receptors. These are divided into two…
Q: Identify the physical and social factors that influence hunger.
A: Hunger is the vigorous urge to eat food. It is also called the craving to eat something. There are…
Q: Doug Schemske is a biologist who studies plants from around the world. Doug and his research team…
A: Natural selection is more of an editing process than a creative one since it filters heritable…
Q: ich of the following urine osmolarities reflects a period of decreased ADH secretion? 301 mOm/L 201…
A: When the body's osmolality rises, the body produces antidiuretic hormone (ADH). This hormone…
Q: (1) List and briefly explain four methods of studying an E-S complex. (2) (a) Which fluorogenic…
A: The four methods for studying the enzyme substrate complex are: 1.An enzyme and a substrate located…
Q: This is about ecological sampling methods in estimating plant cover. Define the following: cover,…
A: Plant cover in ecology is used to measure the abundance of plant species in a relative area covered…
Q: Considering a normal self cell, what might you expect to find in MCH I molecules on the cell…
A: MHC class I molecules (MHC-I) are cell surface recognition elements expressed on virtually all…
Q: Differentiate between lagging strand and leading strand.
A: The first step in the central dogma is DNA replication, in which the DNA strands are recreated to…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Step by step
Solved in 2 steps
- UCA CAG AAA CUG How many amino acids does the mRNA strand above code for?48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of mutation is this? UUU U UUC UUA UCU Phe UCC UAU UGU Cys ANTISENSE 5' GGACCCTAT3' UAC Tyr UGC UAA Stop UGA Stop UAG Stop UGG Trp Ser UCA Leu UUGL" UCG CUU CU CAU) His CAC) CGU CGC CGA Arg CUC C Leu Pro CAA1 Gin CAG) CUA CCA CUG CG CGG AAU AAC Asn AGC AAA AAG Lys AGG Arg AUU ACU AGU Ser AUC lle ACC Thr AUA ACA AGA AUG Met ACG GCU GCC GUU GAU] GGU GUC Val GAC Asp GGC Ala Gly GUA GCA GAA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a FRAMESHIFT SILENT NONSENSE MISSENSE Third letter First letterBM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation Leadple
- 40 Shown below is the antisense strand of DNA. What is the amino acid sequence that corresponds to this code? 5' AAAGCATACCGG 3' Second letter G. UUU Phe UCU UAU) Tyr UGC Cys UGU UUC UCC UAC Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUA UCA UUG Leu UG CAU His CGU CGC CGA CGG CU CUU CUC CUA CUG CAC Pro Leu Arg CCA CAA) Gin CCG CAG AAU AUU AUC lle AUA AUG Met ACG ACU AGU AAC Asn AGC Ser ACC ACA Thr AAA1 AGA AAG Lys AGG Arg GAU) Asp GGC GAC Ala GAA GGU GUU GUC GUA Val GCU GCC Gly GCA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a PRO-VAL-SER-PHE PHE-ARG-MET-ALA GLY-HIS THR-LYS d LYS-ALA-TYR-ARG First letter Third letterE D ot OH ON O Replication R SORO Transcription ORNA processing Translation Gene expression 657 F Q Search % T G LOCLE Y F7 & 87 F8 U 99+ 8 F9 53879 10 F10 O 2 H J K L CV BN MO < F12GENE G DNA GTCGTCTII MRNA Amino Acid
- DNA ATG AGG 11 13 --UCA- MRNA 12 14 TRNA 10 Ser 1511.5 A A Aa-AE-E-¹5- U - abe X₂ X² A-ay-A- Font Ulla Unigriffin DNA: mRNA: amino acids: traits: DNA: traits: mRNA: amino acids: · DNA: mRNA: to search #N O E Et CE- Paragraph $ 15 Ser 1. CAT AGG GAG | CAA GGG TGA CTT TTT | AAT AAT GAC GGG | A E ALT | CAA TTG TTA CGG | AAA AGA CCC | GCC ATA ACA TTT | % STP | CAC CGT CGA | GTA GTA | AGA GGG CAT | TTG TAA GGA GGG GGG TGT | 16 AaBbCcDc AaBbCcl AaBbCcL Aa BbCcDc 1 Normal 1 Body Text 1 List Para... 1 No Spac... W] Tyr 17 Val & 7 Gly E CO OM no num lk T Aa Bb Cc 1 Table Pa (p)) Styles 12 PArg-ser-ser-ala-pro Possibilities mRNA 3’ AGG UCA UCU GCU CCC 5’ 5’ ACC ACG CCU CCU GGC 3’ 3’ UCC ACG CCU ACU GGA 5’ 5’ CGC UCC CCU GCC CCC 3’ Possibilities coding strand 5’ TCC TCG ACT GCT GGA 3’ 3’ TCC TCG TGA CGA CGC 5’ 5’ CGG ACT ACT GCA CCA 3’ 3’ CCC ACG ACT CCT CGC 5’ Possibilities non- coding strand 3’ GGG TCA TCA CGG GGG 5’ 5’ TCC AGC AGC CGC GGC 3’ 3’ GCC TCA AGC CGA GGA 5’ 5’ TGG TGC TGA AGA TCA 3’
- COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGCThis is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.Give the mRNA and amino acid sequence from this DNA strand: TACATACCTCGGCTTTGGCTGAAAGGTACTTATAATGCT