5. DNA is made of two strands that are antiparallel. If one strand runs from 3' to 5' direction the other one will go from 5' to 3' direction. During replication or transcription, whatever the process is, it will always follow the 5' to 3' direction using the 3' to 5' directed strand as the template strand. Therefore, if following is the DNA sequence 5'-CCG ATC GCA CAA-3’ a) Using this sequence as template after transcription no protein can be translated. Why? I. Presence of start codon II. Absence of start codon III. Due to mutation b) If you want to start the translation, what change you need in the second codon (from 5' to 3' direction)? I. Substitution of C with G II. No change III. Deletion of C IV. Both I & III

Q: The arrow in the diagram below indicates the direction of movement of the replication fork. 5' A C B…

A: CENTRAL DOGMA OF LIFE   DNA replicates to form   ↓   DNA undergoes transcription to form   ↓   mRNA…

Q: The following represents a DNA strand in the process of replication. The bottom sequence is that of…

A: DNA replication is the process in which a copy of already existing genome is formed. A pair with T…

Q: Considering the structure of DNA, what kind of bonds hold one nucleotide to another within one side…

A: We know that DNA is the molecule which store the biological information . It is a complex molecule…

Q: This is the original strand of DNA: ATG AAG TTT GGC TAA - what would represent a frameshift mutation…

A: A mutation refers to any alteration in the sequence of DNA (deoxyribonucleic acid) due to some…

Q: ) give 3 differences between replication in prokaryotes and replication in Eukaryotes

A: DNA replication is the process by which a double-stranded DNA molecule is copied to produce two…

Q: The arrow in the diagram below indicates the direction of movement of the replication fork. 5' A B C…

A: During DNA replication, the two strands of the DNA double helix are separated and each strand serves…

Q: Look at the double-stranded segment of DNA shown below. Imagine that the two strands have already…

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid in which…

Q: The coding strand has the following sequence. Please answer the questions below with regard to this…

A: The coding strands run in 3' to 5' direction and has codons it is transcribed as it is in the mRNA…

Q: In the following diagram of a replication fork, primers are shown as thick black lines and newly…

A: The heterocatalytic process by which a new DNA stand is synthesized on a old DNA template is known…

Q: 8. For the double strand DNA molecule below, assume the 3' DNA strand acts as the template for…

A: The process in which the DNA is converted into mRNA is called transcription and in which mRNA is…

Q: DNA duplication TAT GCA CTA ATA TAT GCA [triplets] ____ ____ ____ ____ _____ ____ Protein synthesis,…

A: The process of duplicating or replicating the given template stand DNA is called replication. Next…

Q: replication fork and the synthesis of the new strand can continue without interruption as the…

A: Replication is the process in which DNA duplicates itself. Replication occurs when the replication…

Q: In the diagram shown below representing a replisome, the portion represented by the letter functions…

A: Ans. The method of DNA replication is a process in which double-strand DNA molecule copying in order…

Q: 10. A replication bubble is shown below, with the origin of replication represented by a black dot.

A: In this question, we have to answer about the process of replication.

Q: The following is a section of DNA removed from a cell nucleus: 5'…

A: The basic physical and functional unit of heredity is the gene. DNA is the material that makes up…

Q: What is the name of the DNA strand which copies the MRNA?

A: The DNA is genetic material in living organisms that is made up of two antiparallel polynucleotide…

Q: A particular triplet of bases in the template strand of DNA is 3'-ACT-5'. The complementary DNA…

A: The complementary strand is created using the base-pairing rules of DNA, where adenine (A) always…

Q: 12. A sequence of nucleotides is shown below, along with an indication of an origin of replication:…

A: Replication is the process of synthesizing new DNA from the parental DNA.

Q: Shown below is the " sense" strand of DNA. Second letter U What is the amino acid sequence that…

A: Introduction :- Deoxyribonucleic acid (DNA) is a molecule made up of two polynucleotide chains that…

Q: If a sequence of one strand of DNA is 5'-TGACTATC-3', what is the complementary strand?…

A: DNA is a macromolecule and is composed of two complementary strands. Bonds which is formed between…

Q: Selective destruction of a motoneurons in the spinal cord will have which of the following effects…

A: Introduction Muscles are soft tissues found in both animals and humans, it is the fibrous tissue in…

Q: What is the name of the enzyme, shown as the yellow blob circled in red, that opens the helix and…

A: The replication is a process by which new DNA is produced from the old DNA. In the S-phase of cell…

Q: 1. The image shown in Figure 1 below represents a strand of DNA following replication. The black…

A: DNA repair mechanisms helps to repair many accidental lesions that occurs continuously in DNA.…

Q: 1. Complete the structure of this section of a DNA molecule. Label each base (A.I,G,C), sugar (S)…

A:

Q: Directions: 1. Use the DNA code to make a replicated copy of DNA. 2. Use the replicated DNA code to…

A: Replication : it is the process where DNA duplicates Transcription: the process of making an RNA…

Q: 6. The following diagram shows a replication bubble within a double stranded DNA molecule. The red…

A: Replication is the first and foremost step of the three steps of central dogma in gene expression.…

Q: Given the DNA template strand 3' GCATTCAAG 5', write the amino acid sequence in the N‑terminal to…

A: Amino acids are the basic units (monomers) that makeup proteins. They consolidate to frame short…

Q: a. Below is a portion of a bacterial chromosome that contains a gene. The promoter region and the +1…

A: Transcription is a process in which a DNA strand is transcribed into mRNA by an RNA polymerase…

Q: What is the Complimentary DNA Strand to CGTCAGCAGACGAAAGGGCTTGCGGCGCGC. What is the content of CG in…

A: To find the complementary DNA (cDNA) strand, we need to identify the base pairs for each nucleotide…

Q: The beginning of the hexose kinase gene's sequence can be found below, the +1 nucleotide is…

A: Given:

Q: Give the mRNA and amino acid sequence from this DNA strand: TACATACCTCGGCTTTGGCTGAAAGGTACTTATAATGCT

A: By the process of transcription the DNA strand is transcribed into mRNA within the nucleus of the…

Q: the diagram below, label the: DNA double helix RNA transcript Template strand • Coding strand • 5'…

A: Transcription is a key biological activity that happens within living organisms  cells. It is a…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.