1. The image shown in Figure 1 below represents a strand of DNA following replication. The black lines present above the top and below bottom strands of DNA represent the phosphodiester backbone of the molecule. Examine the DNA strands and locate any sites that are damaged, mismatched, or otherwise require repair. Indicate where in the strand the specific lesion is located, and provide a detailed overview of the post-replicative repair process that would likely be used to rectify the lesion. Assume that each lesion, even those that are located in close proximity will be repaired separately. CH CH, CH₁ CH, CH, OCH, CH, OCH₂CH₂ GATCCGAATCGGCTAGGATCGGCATCCGATTCGATCGGCATCCGATCGCTA CTAGGATTA CCGACCCTAGCCGTAGGGTAACGTAGCCGTAG CH₁ CH₂ CGATCGATC TAGCGACO SATGCTAGCTAG Figure 1: Graphical Representation of a strand of dsDNA containing errors and damage following replication
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Trending now
This is a popular solution!
Step by step
Solved in 3 steps