14. Guanine normally pairs with cytosine. Oxidative damage can result in the modification of guanine to 8-oxoguanine. What is the potential mismatch in nucleotides that can occur following replication? 8-oxoguanine pairs with Adenine 8-oxoguanine pairs with thymidine Thymidine pairs with adenine Guanine pairs with Cytosine None of these choices. Question 8 The key enzyme that transfers an a-amino group from an amino acid to an a-keto acid is : Glutamate Dehydrogenase Transaminase Synthetase Glutamine PRPP Amidotransferase Glutaminase

Q: In the following diagram of DNA replication fork, A is_. A e 5' 3'OH 3 OH

A: DNA ( deoxyribonucleic acid) ismade up of repeating units of the nucleotides, hence these are known…

Q: Given a part of DNA undergoing replication. Copy and write the corresponding bases in the new…

A: Semiconservative mode of DNA replication describes the mechanism of DNA replication in all living…

Q: 8. DNA basic structure: Below, I have drawn a representation of a single strand of DNA. Draw a…

A: The self replicating molecules that are present in the chromosomes and carry genetic information are…

Q: Using your own words and including the phrases “5' to 3" and "3' to 5" explain how a double helix of…

A: The genetic material of many species, including humans, is DNA, or deoxyribonucleic acid. The…

Q: Terms (each is used once) 3' end 5' end 1' carbon of deoxyribose 5' carbon of deoxyribose 5 carbon…

A: "DNA, or deoxyribonucleic acid, is a remarkable molecule that serves as the blueprint for life's…

Q: Below is a DNA parent strand. What would be the daughter strand to this? What step of cell…

A: DNA replication is the process by which a cell makes an identical copy of its DNA before cell…

Q: 16/ The phosphates that make up the phosphodiester bonds in DNA have pKa  2. What is the sign of…

A: pKa of the phosphodiester bond in DNA = 2 It is desired to calculate the charge on DNA at neutral…

Q: What the weak force that contributes most to the stability of the DNA double helix? base-stacking…

A: DNA double helix is composed of nucleic acids attached with each other through phosphodiester bonds.…

Q: As a result of the rotation about its six bonds, DNA can exist in a variety of forms. Determine…

A: There are 3 major DNA variants. They are A-DNA, B-DNA and Z-DNA.  In all these variants, A pairs…

Q: 3) Where is Deoxyribose sugar found? Where is Ribose sugar found? 4) What are the parts of a…

A: Since you have posted a question with multiple sub-parts, we will solve the first three subparts for…

Q: Just question 33

A: The error in the cell at the time of replication generally does not cause cancer as they are…

Q: explain why you chose that answer. Your explanation should discuss the replication of DNA in…

A: DNA replication is the process by which a double-stranded DNA particle is duplicated to deliver two…

Q: 115. E.coli has only 4.6 ×10° base pairs and completes the process of replication within 18 minutes;…

A: The answer will be 2000 if the process of replication occurs within 38 minutes. So, the answer is…

Q: TRUE OR FALSE 1. Both strands of a daughter DNA molecule are formed through the linking of…

A: The nucleic acid polymer has nucleotide as its monomeric unit. Nucleotides are essential in the…

Q: Which of the following statements about the DNA is FALSE? O DNA occurs in the form of double…

A: Deoxyribonucleic acid (DNA) is the genetic material of the cell. It has the information for…

Q: To maintain uniform diameter of the DNA double helix, only purines base with each other via two…

A: DNA is the fundamental structure that carries all the information of a living thing. In most cases,…

Q: ACTIVITY 2: Protein Synthesis DNA: 3' A G C C G T A GA AТТ 5' 1. Using this strand of DNA as a…

A: Cells create proteins through a mechanism known as protein synthesis. Transcription and translation…

Q: Which nucleotide is most non-polar and why? What structural element of DNA gets cleaved by…

A: The monomeric units of nucleic acids are called nucleotides. Nucleotides are generally…

Q: What is the correct order of enzyme action during DNA replication? O Priming, helicase/topoisomerase…

A: DNA replication is the process by which a cell copies its entire genome to pass on to its daughter…

Q: TRUE OR FALSE] 11. The structure of the DNA, being super coiled, promotes increased viscosity of…

A: Nucleic acid was first discovered by Friedrich Miescher from the nuclei of the pus cells…

Q: this 14. Synthesize a complementary strand of DNA for this strand:

A: DNA is a double helical structure. In DNA, strands are antiparallel , one strand is in 5’ to 3’…

Q: What are the consequences of having pyrimidine dimers in DNA? They prevent the transcription of…

A: Deoxyribonucleic acid (DNA) is the hereditary material in humans and almost all other organisms,…

Q: 1. Compare and contrast replication and transcription. Replication Transcription Where on the DNA…

A: DNA replication is the process of production of identical copies of DNA molecules with the help of…

Q: 31. During DNA repair in both prokaryotes and eukaryotes, which of the following enzymes forms a…

A: DNA is a double stranded, helical macromolecule in which the strands are antiparallel. DNA is…

Q: A 918,980 Å long double stranded DNA molecule is the B-conformation. If the DNA has has alternating…

A: DNA (Deoxyribonucleic acid) has two strands. These strands bond with each other hydrogen bonds. The…

Q: TRUE OR FALSE 1. The RNA molecules could be found in the nucleoplasm 2. The cyclobutane pyrimidine…

A: There are two types of nucleic acids : DNA : Deoxyribonucleic acid RNA : Ribonucleic acid  DNA and…

Q: The difference between a nucleoside and nucleotide is:  Group of answer choices 1. A nucleoside…

A: Hi, Thanks For Your Question. Answer : Correct Option Is 1 (nucleoside consists of the sugar with a…

Q: 1. What would be the amino acid sequence encoded by the MRNA 5'CCAUGACGUCGGAUCAAUGAGC 3' 2. If the…

A: DNA replication is the process in whichbbhvgvhghhccvfgcbgvh

Q: Cytosine Adenosine 5'- monophosphate Deoxycytidine 5'- monophosphate 1. a nucleoside Cytidine 2. a…

A: The nucleotides are the building blocks for the nucleic, that is, DNA (deoxyribonucleic acid) and…

Q: Question: Which of these statements is TRUE if there is 40% Guanine in a strand of DNA? O There is…

A: Calculation of percentage of bases in a DNA According to chargaff's rule, the concentration of…

Q: During DNA replication, an incoming nucleotide is enzymatically joined to the preceding nucleotide…

A: Phosphodiester bond Explanation:-In DNA and RNA, the phosphodiester bond is the linkage between the…

Q: The nucleotides were chemically modified. Select the modification that will result in a nucleotide…

A: Nucleotides are of two types, ribonucleotides and deoxyribonucleotides. Ribonucleotides are composed…

Q: Question 3 Not yet answered Points out of 1.00 P Flag question Which of the following have…

A: Nucleic acids are the molecules that cells use to store, transfer and express genetic information.…

Q: Imagine you were asked to extract DNA from the cells of another plant species. Choose 3 species of…

A: DNA extraction from plant tissues is easier compared to animal tissues. Everyday items like shampoo,…

Q: 1. Write the complementary base sequence for the matching strand in the following DNA section:…

A: Introduction: Complementarity is the fundamental concept of DNA replication and transcription since…

Q: One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base…

A: DNA stands for deoxyribonucleic acid. It is made up of nitrogenous bases (ATGC), deoxyribose sugar…

Q: Given the structures of ddATP and DATP: NH2 NH2 N. HO-P- OH OH OH OH OH OH ddATP DATP A) What would…

A: Chain termination method relies on the  use of dideoxyribonucleoside triphosphates, derivatives of…

Q: QUESTION 4 Which of the following DNAs is most likely to contain the recognition sequence for a…

A: DNA (Deoxyribonucleic acid) recognition sequence is a specific linear sequence that is recognized by…

Q: Which of the following have nitrogenous bases correctly paired in DNA? Select one: O a.…

A: DNA or deoxyribonucleic acid is the genetic material of most living organisms except for certain…

Q: Iv been marked with 3 wrong answers for this problem. please help me identify my mistake. Is Dna…

A: DNA consist of two strands. The smallest unit is nucleic acid and each nucleic acid is joined by…

Q: parts of the diagram (labeled A-F) with the corresponding tem t A parental duplex 5' 3' fork…

A: Nucleic acids are biopolymers made of repeating units of nucleotides. The DNA is a nucleic acid…

Q: What is the name of proteins that relax supercoiled state of a DNA molecule are called? Polymerase…

A: During the process of transcription and DNA replication overwinding of the DNA duplex would lead to…

Q: ou turn up the heat to 95° Which is the most likely outcome? Explain your answer.   Both duplexes…

A: Polymerase chain reaction (PCR) is versatile in vitro method for amplifying the defined target DNA…

Q: Mismatch repair

A: DNA Repair: DNA repair is defined as the system of cellular responses which are associated with the…

Q: This image depicts an organism viewed under the microscope at 1000x. The diameter of the field of…

A: The cells are the smallest structural and functional unit of the body. It is characterized by the…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.