Q: The arrow in the diagram below indicates the direction of movement of the replication fork. 5' A C B…
A: CENTRAL DOGMA OF LIFE DNA replicates to form ↓ DNA undergoes transcription to form ↓ mRNA…
Q: What factor is used repeatedly for lagging strand DNA replication but not repeatedl strand…
A: Qno 18 DNA Polymerase 3 is the factor which used repeatedly for lagging strand DNA replication but…
Q: Give the sequence of the complementary DNA strand for the DNA chain with the following base sequence…
A: DNA means deoxyribonucleic acid. DNA acts as the genetic material in most of the organisms present…
Q: DNA A= 5' GGG GCT AGC CCC 3' DNA B= 3' ATA TAT ATA CCC 5' DNA C= 5' TAC GTT ACG TCG 3' DNA D= 3' ATC…
A: DNA is a hereditary material that is made up of adenine Guanine Cytosine and Thymine. As it is a…
Q: DNA is shaped like a twisted ladder. What do we call this shape/structure? * Single Strand Double…
A: Biological macromolecules are those large molecules that are necessary for the survival and growth…
Q: Fill in the blanks in the following statements about DNA replication. 3' Parental strand 5' 2. Then…
A: “Since you have posted a question with multiple sub-parts, we will solve first three sub-parts for…
Q: Why is telomerase not needed in prokaryotic DNA replication? O Prokaryotes have circular DNA O…
A: The telomerase is responsible for end replication in case of eukaryotic cells which perform RNA…
Q: 4. A binds with 5. What enzyme prevents recoiling of the DNA strand while synthesis is occurring?…
A: DNA replicationUnderstanding is the process by which a cell makes an identical copy of its entire…
Q: A. True B. False 4. Every phosphate is connected to a sugar 5. Uracil is present in RNA replication…
A: The process by which identical copy of double stranded DNA is made by using the old DNA strand. The…
Q: The diagram shows the structure of DNA with complementary base pairing between strands. Bood 3' CG…
A: Double-stranded DNA has two strands of complementary DNA wherein Adenosine is bonded to Thymine via…
Q: phosphodiester bonds 8 0-2-0-3 O HCS H₂C 8-6-0 H₂C OH O 0-6-0 H₂C OH O 2 purine pyrimidine T Strand…
A: DNA (Deoxyribonucleic Acid) is a double-stranded structure that carries the genetic instructions of…
Q: THCA 100 This reaction is Entropy is THC ( Leafly Mur AD RNA polymerase ATGACGOATCAGCCOCAAG…
A: Tetrahydrocannabinol Acid when heated converts into delta-9-tetrahydrocannabinol. the reaction is…
Q: Cytosine Adenosine 5'- monophosphate Deoxycytidine 5'- monophosphate 1. a nucleoside Cytidine 2. a…
A: The nucleotides are the building blocks for the nucleic, that is, DNA (deoxyribonucleic acid) and…
Q: What is the nucleotide sequence of the complementary strand of this molecule AT GCGA? O CATAG O A AT…
A: Deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) are well known and well defined as the two…
Q: DNA coding strand ATG GGA ATT CGC can not get this what the sequence of the complementary template…
A: The DNA strand which functions as template for RNA synthesis is known as template strand, minus…
Q: The single strand of DNA below forms a hairpin structure with a loop that is 5 nucleotides long. 5'…
A: Hydrogen bonds between nucleotides that are complementary in the loop and stem regions help to…
Q: Give
A: Introduction:- The central dogma of biological sciences explains how genetic information is…
Q: DNA synthesis
A: DNA: It is deoxyribonucleic acid which is a double-stranded nucleic acid which contains genetic…
Q: Which of the following molecules is a nitrogen base that would be found in 1 po DNA? (check all that…
A:
Q: Examine the 5 -3' sequence of bases of the DNA molecules (A D) shown below. I am only showing you…
A: For option A, AAAT the complementary strand is TTTA. In this A pairs with T by two hydrogen bonds…
Q: Which of the following is not depicted in the diagram?* O Okazaki fragment O Replication fork O…
A: The diagram is showing ongoing Replication. Replication is the process by which double stranded DNA…
Q: DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’, whats the non-template/sense/coding strand from the STARND…
A: During the process of transcription, one of the two DNA strands serves as a template for the…
Q: Similar to prokaryotes, eukaryotes have a topoisomerase-ll-class enzyme called DNA gyrase, which can…
A: Topoisomerases are enzymes that catalyze the overwinding or underwinding of the DNA. This issue is…
Q: which of the follocoing waeleng ths ranges is use d to measue absorbence of DNAĄ 10 0 - 2oonm 200…
A: Deoxyribonucleic acid(DNA) is one of the most important biochemical compounds for living cells. It…
Q: Show the replication strands in each of these bubbles (note they have different DNA orientations).…
A: DNA Replication Replication of DNA is a process of duplication of DNA, carried out by DNA…
Q: Conjugation results in the transfer of genetic material between two bacterial cells, but only occurs…
A: Given: Conjugation results in the transfer of genetic material between two bacterila cells. It…
Q: 6. Follow the directions from Investigation 5 for the following sequence: HUMAN GENOMIC SEQUENCE…
A: This exercise is about transcription and translation. Transcription is the process in which RNA…
Q: a G-C A What are you looking at in the above figure? Something that Watson, Crick and Franklin first…
A: DNA is the main genetic material that is present in every human cell. This is also a key portion of…
Q: In Eukaryotes, some hydrogen bonds are formed in between amino acids of the histones and…
A: DNA and RNA are made up of long chains of nucleotides and ribonucleotides bases. Sugar…
Q: One strand of DNA runs 5' to 3' the other runs 3' to 5, therefore the two strands of DNA are sald to…
A: Cell Cycle It is an ordered series of events involving cell growth and cell division that produces…
Q: A strand of DNA has the sequence 5'-AGTC-3'. What is the sequence of the complementary strand in the…
A: The DNA has two strands which are comprised of nucleotides- A stands for adenine, T stands for the…
Q: 8 of 15 GTTAA Plasmid Insert Ligase Glycosylase RATT G -O In this diagram, name the enzyme that…
A: Plasmid is extra chromosomal DNA. It has the ability to self replicate.
Q: . The DNA strand whose %T is 50%
A: DNA Deoxyribonucleic Acid (DNA) is the genetic material of many organisms including viruses,…
Q: Write down the DNA strand which is complementary to the strand shown below. Be sure to mark the ends…
A:
Q: A typical bacterial chromosome, such as in the case of Escherichia coli, is a circular…
A: Bacterial chromosomes are located in a nucleoid, a distinct cytoplasmic structure.
Q: DNA A= 5' GGG GCT AGC CCC 3' DNA B= 3' ATA TAT ATA TCC 5' DNA C= 5' TAC GTT ACG TCG 3' DNA D= 3' ATC…
A: DNA is a thread-like chain of nucleotides. The order of these nucleotides determines the information…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Given the diagram of the replication fork below, indicate the chemical group (5'-P, 3'-P, 3'-OH or 5'-OH) most likely to be found at the sites indicated below by the dots labeled A, B, and C.On the 4 diagrams below show the four different ways (which strands are cut and where for each Holliday junction) that the Holliday junction structures can be resolved and denote whether this leads to a recombination event or not." 3 1 IT |? 3 ||| |AL||T|||c| |||| 4 5 6 TIT!!T?L|| ?|||?| |||| TIT|| |AL||T|||C| |||| 4 5 6 3 3' 3 T?L|| ?| ||?| |!!! || |A|||T| |jcj ||| 4 5 6 TI T?L|| ?|||?T ||| jT|| |ALİ|Ti||c| ||| 4 5 67.
- Below is a depiction of a replication bubble. 5' AGCTCCGATCGCGTAACTTT 3' TCGAGGCTAGCGCATTGAAA CTAAAGCTTCGGGCATTATCG 3' GATTTCGAAGCCCGTAATAGC TATCGACS Consider the following primer which binds to the DNA replication bubble on the diagram above: 5'-GCUAUCG-3' Identify the DNA sequence to which this primer would bind and the orientation. If the replication fork moves to the right, will the primer be used to create the leading strand of replication or the lagging strand? Explain your answer b. If the replication fork moves to the left, will the primer be used to create the leading strand of replication or a. the lagging strand? Explain your answer. What would the next five nucleotides added to the primer by DNA polymerase? С.Using Figures 8.7 and 8.9 as a guide, draw a dinucleotide composed of C and A. Next to this, draw the complementary dinucleotide in an antiparallel fashion. Connect the dinucleotides with the appropriate hydrogen bonds. FIGURE 8.9 The two polynucleotide chains in DNA run in opposite directions. The left strand runs 5 to 3, and the right strand runs 3 to 5. The base sequences in each strand are complementary. An A in one strand pairs with a T in the other strand, and a C in one strand is paired with a G in the opposite strand. FIGURE 8.7 Nucleotides can be joined together to form chains caled polynucleotides. Polynucleotides are polar molecules with a 5 end (at the phosphate group) and a 3 end (at the sugar group). An RNA polynucleotide is shown at the left, and a DNA polynucleotide is shown at the right.Multiple Replication Forks in E. coli II On the basis of Figure 28.2, draw a simple diagram illustrating replication of the circular E. coli chromosome (a) at an early stage, (b) when one-third completed, (c) when two-thirds completed, and (d) when almost finished, assuming the initiation of replication at oriC has occurred only once. Then, draw a diagram showing the E. coli chromosome in problem 3 where the E. coli cell is dividing every 20 minutes.
- Give the base sequence of the complementary DNA strand of the DNA chain with the following base sequence: 5’ ACGTAG 3’For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the complementary DNA strandIn Figure 1-8b, can you tell if the number of hydrogenbonds between adenine and thymine is the same as thatbetween cytosine and guanine? Do you think that aDNA molecule with a high content of A + T would bemore stable than one with high content of G + C?
- Identify the leading and lagging strands for each (A through D) in the figure below. origin A 51 3' 3'DNA Replication occurs on both prokaryotes and eukaryotes. Although they have a similar genetic flow, there are small differences in between. What are the differences of DNA replication in prokaryotes and eukaryotes? What is/are the major difference/s?None
