(n-m)! Count the number of ways in which: Guanıne, Adenine, Cytosine, Thymıne, Cytosine, and Guanıne (6 bases) be sequenced in one DNA strand?

Q: At a specific area of this chromosome, the sequence of nucleotides below is present where the chain…

A: The region of DNA known as the replication fork is where the replication process itself is now…

Q: 2. How are enzymes involved in this process? 3. What happens when DNA "unzips"? 4. Why is it…

A: This page contain link but that link is not opening so we are answering first 3 questions. For rest…

Q: Write the complementary strand for each of the following strands of DNA. Part 1 of 4 5'-TTCGAAAA-3'…

A: Important information:DNA consists of two complementary strands that run in opposite directions…

Q: O 3'-GTA-CAG-CCG-CGT-5' ) 5'-CAC-GUC-GGC-GCA-3' 3'-CAT-GTC-GGC-GCA-5"

A: His-Val-Gly-Ala His= CAC Val=GUC Gly=GGC Ala=GCA   these amino acids get coded by other codes too,…

Q: Sometimes DNA polymerase makes a mistake, and the wrong nucleotide is added to the growing DNA…

A: In the realm of genetic mutations, scientists have observed a notable discrepancy between two…

Q: Which of the following statements about polynucleotide formation is correct? As a polymer, DNA is…

A: given are some statements regarding polynucleotide formation and the correct among them is given…

Q: How would I solve this? primer (5’ TCAAAACG 3’ ) is shown hybridized to its template DNA below.…

A: The question inquires about the Sanger sequencing method, a strategy utilized to decide the grouping…

Q: To maintain uniform diameter of the DNA double helix, only purines base with each other via two…

A: DNA is the fundamental structure that carries all the information of a living thing. In most cases,…

Q: One strand of a double-helical DNA has the sequence 5'-GCGCAATATTTCTCAAAATATTGCGC-3'. Write the base…

A: Introduction DNA is the molecular structure that is composed of a pair of polynucleotide chains…

Q: Below is a picture of a single origin of replication in a eukaryotic cell. 5' 37 5' 1. On the figure…

A: DNA replication is the process by which new DNA strands are produced from the old DNA molecule by…

Q: Although DNA polymerases require both a template and a primer, the following single-stranded…

A: DNA polymerases require both a template and a primer to synthesize DNA. However, some…

Q: Sequencing of the following fragment of single-stranded DNA needs to be undertaken using the Sanger…

A: Sanger sequencing, also referred to as the “chain termination method”, may be a method for…

Q: 7 a-d. i. ii. Draw the Hydrogen bonds between the base pairs and label the atoms that participate in…

A: There are 2 conventional base pairs in DNA. They are; Between Adenine and Thymine Between Guanine…

Q: Instructions: Put the following terms into a word map to explain how they are interrelated for DNA…

A: DNA has the ability to self replicate. It undergoes semi-conservative replication. DNA Replication…

Q: EcoRI --- 5' G - AATTC 3'       5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3'     3'…

A: The DNA is formed of several repeating units of monomers called nucleotides. The adjacent…

Q: EcoRI recognizes G A-A-T-T-C sequence and cleave/ cut between G and A. How will the DNA fragments…

A: A restriction site or recognition site, is a specific sequence of nucleotides in DNA that a…

Q: 5’ TAAGCGTAACCCGCTAA   CGTATGCGAAC   GGGTCCTATTAACGCAC 3’ 3’ ATTCGCATTGGGCGATT   GCATACGCTTG…

A: The DNA is a double stranded molecule which are paired along with a complimentary strand. The above…

Q: Draw the following strands of DNA 5’ C-A-T 3’ as well as the complementary base pairing strand…

A: Two strands of DNA twist around one another to form a double helix DNA and both are in anti-parallel…

Q: DNA is made of two strands that are antiparallel. If one strand runs from 3’ to 5’ direction the…

A: Deoxyribonucleic acid (DNA) is a biomolecule found in nearly all living organisms. The structure of…

Q: How many hydrogen bonds exist between this DNA strand and its complementary strand? 5'-TTAGGAG-3'

A: DNA strands are boned together with the help of hydrogen bonds present between the base pairs. These…

Q: None

A: 1. The processes of DNA replication and transcription are vital to the growth and development of…

Q: How many hydrogen bonds exist between this DNA strand and its complementary strand? 5'-CACGGGG-3'

A: Deoxyribonucleic acid (DNA) is a double stranded polynucleotide coiled around a central axis to form…

Q: Which of the following descriptions of regions A, B, and Care INCORRECT? A = minor groove, sugar…

A: On one side of the helix, the strand backbones are closer together than on the other. When the…

Q: Given the DNA template strand 3' GCATTCAAG 5', write the amino acid sequence in the N‑terminal to…

A: Amino acids are the basic units (monomers) that makeup proteins. They consolidate to frame short…

Q: DNA polymerase I, DNA ligase, and topoisomerase I catalyze the formation of phosphodiester bonds.…

A: The DNA replication is a semi-conservative mechanism in which the new complementary strand is…

Q: 49 N), heavy parental DNA, and all nucleotides with 14N (another isotope of N) as "nucleotide supply…

A: We can use different shades or different colors represent a daughter strand of DNA with light N…

Q: DNA Polymerase Holoenzyme Il is represented below. It consists of several domains with distinct…

A: At the replication fork, DNA polymerase III holoenzyme (Pol III HE) works with the helicase and…

Q: How many hydrogen bonds exist between this DNA strand and its complementary strand?…

A: As per the general rule, the base adenine (A) always pairs with thymine (T) and the guanine (G)…

Q: Which of the following statements about polynucleotide formation is correct? As a polymer, DNA is…

A: Introduction  A polynucleotide consisits of many nucleotide monomers. DNA is made up of…

Q: All guanines in the top strand of following sequence undergo a chemical change so that they now pair…

A: Two identical DNA molecules, each made up of one original strand (the template strand) and one…

Q: ’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ Fill in the complimentary DNA strand and…

A: Watson and Crick elucidated in 1953 , the famous double stranded structure of the DNA molecule and…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.