Homework Help is Here – Start Your Trial Now!
Science
Biology
mRNA: TCCGATGCCACGGGTCATCTCGGACGTGTGAATCGA 3. Your mRNA will now be translated. Refer to the genetic code on page 2. a. Copy your mRNA strand below for convenience. b. Find and underline the first AUG you see. This is the start codon and the ribosome begins translation here. c. Underline every codon (three bases) after the AUG. The ribosome reads each codon to know which amino acid should come next. d. Translate the mRNA. Write the 3-letter abbreviation for each amino acid below each codon. MRNA: protein:

mRNA: TCCGATGCCACGGGTCATCTCGGACGTGTGAATCGA 3. Your mRNA will now be translated. Refer to the genetic code on page 2. a. Copy your mRNA strand below for convenience. b. Find and underline the first AUG you see. This is the start codon and the ribosome begins translation here. c. Underline every codon (three bases) after the AUG. The ribosome reads each codon to know which amino acid should come next. d. Translate the mRNA. Write the 3-letter abbreviation for each amino acid below each codon. MRNA: protein:

Human Anatomy & Physiology (11th Edition)
Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:Elaine N. Marieb, Katja N. Hoehn
Chapter1: The Human Body: An Orientation
Section: Chapter Questions
Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...
See similar textbooks
icon
Related questions
Question
### mRNA Translation Activity #### mRNA Sequence ``` TCCGATGCCACGGGTCATCTCGGACGTGTGAATCGA ``` #### Instructions for Translation 3. **mRNA Translation** - Your mRNA will now be translated. Refer to the genetic code on page 2. **Steps:** a. **Copy your mRNA strand below for convenience.** b. **Identify the Start Codon** - Find and underline the first `AUG` you see. This is the start codon and the ribosome begins translation here. c. **Identify Codons** - Underline every codon (three bases) after the `AUG`. The ribosome reads each codon to determine which amino acid should come next. d. **Translate the Sequence** - Translate the mRNA and write the 3-letter abbreviation for each amino acid below each codon. #### Spaces for Completion - **mRNA:** ``` (Write the transcribed mRNA strand here) ``` - **Protein:** ``` (Write the translated protein sequence here) ```
Transcribed Image Text:### mRNA Translation Activity #### mRNA Sequence ``` TCCGATGCCACGGGTCATCTCGGACGTGTGAATCGA ``` #### Instructions for Translation 3. **mRNA Translation** - Your mRNA will now be translated. Refer to the genetic code on page 2. **Steps:** a. **Copy your mRNA strand below for convenience.** b. **Identify the Start Codon** - Find and underline the first `AUG` you see. This is the start codon and the ribosome begins translation here. c. **Identify Codons** - Underline every codon (three bases) after the `AUG`. The ribosome reads each codon to determine which amino acid should come next. d. **Translate the Sequence** - Translate the mRNA and write the 3-letter abbreviation for each amino acid below each codon. #### Spaces for Completion - **mRNA:** ``` (Write the transcribed mRNA strand here) ``` - **Protein:** ``` (Write the translated protein sequence here) ```
### Genetic Code Chart This image depicts a standard genetic code chart used to translate mRNA codons into amino acids. #### Codon Chart Layout: - **Columns and Rows**: The chart is a 4x4 grid representing the possible combinations of nucleotides in mRNA codons. Each codon consists of three nucleotides represented by the letters U, C, A, and G. - **First Letter (Vertical on Left)**: Indicates the first nucleotide of the codon. - **Second Letter (Horizontal at Top)**: Indicates the second nucleotide of the codon. - **Third Letter (Vertical on Right)**: Indicates the third nucleotide of the codon. #### Codons and Corresponding Amino Acids: - Each cell in the grid contains the three-nucleotide codon and its corresponding amino acid abbreviation: - **UUU, UUC**: Phenylalanine (Phe) - **UUA, UUG, CUU, CUC, CUA, CUG**: Leucine (Leu) - **UCU, UCC, UCA, UCG**: Serine (Ser) - **UAU, UAC**: Tyrosine (Tyr) - **UAA, UAG, UGA**: Stop codons, indicating the termination of protein synthesis. - **UGU, UGC**: Cysteine (Cys) - **UGG**: Tryptophan (Trp) - **CUC, CCA, CCG**: Proline (Pro) - **CAU, CAC**: Histidine (His) - **CAA, CAG**: Glutamine (Gln) - **CGU, CGC, CGA, CGG**: Arginine (Arg) - **AUU, AUC, AUA**: Isoleucine (Ile) - **AUG**: Methionine (Met) and also serves as a start codon. - **ACU, ACC, ACA, ACG**: Threonine (Thr) - **AAU, AAC**: Asparagine (Asn) - **AAA, AAG**: Lysine (Lys) - **AGU, AGC**: Serine (Ser) - **AGA, AGG
Transcribed Image Text:### Genetic Code Chart This image depicts a standard genetic code chart used to translate mRNA codons into amino acids. #### Codon Chart Layout: - **Columns and Rows**: The chart is a 4x4 grid representing the possible combinations of nucleotides in mRNA codons. Each codon consists of three nucleotides represented by the letters U, C, A, and G. - **First Letter (Vertical on Left)**: Indicates the first nucleotide of the codon. - **Second Letter (Horizontal at Top)**: Indicates the second nucleotide of the codon. - **Third Letter (Vertical on Right)**: Indicates the third nucleotide of the codon. #### Codons and Corresponding Amino Acids: - Each cell in the grid contains the three-nucleotide codon and its corresponding amino acid abbreviation: - **UUU, UUC**: Phenylalanine (Phe) - **UUA, UUG, CUU, CUC, CUA, CUG**: Leucine (Leu) - **UCU, UCC, UCA, UCG**: Serine (Ser) - **UAU, UAC**: Tyrosine (Tyr) - **UAA, UAG, UGA**: Stop codons, indicating the termination of protein synthesis. - **UGU, UGC**: Cysteine (Cys) - **UGG**: Tryptophan (Trp) - **CUC, CCA, CCG**: Proline (Pro) - **CAU, CAC**: Histidine (His) - **CAA, CAG**: Glutamine (Gln) - **CGU, CGC, CGA, CGG**: Arginine (Arg) - **AUU, AUC, AUA**: Isoleucine (Ile) - **AUG**: Methionine (Met) and also serves as a start codon. - **ACU, ACC, ACA, ACG**: Threonine (Thr) - **AAU, AAC**: Asparagine (Asn) - **AAA, AAG**: Lysine (Lys) - **AGU, AGC**: Serine (Ser) - **AGA, AGG
Expert Solution
Step 1

Inside the nucleus of the cell , DNA act as a  template for the manufacturing of single strand of mRNA. This is called transcription . mRNA is always read from 5' - 3' Direction.

Similarly , inside the cytoplasm of the cell , protein synthesis takes place with the help of mRNA strand . Thus strand consists of Animo group at one end while carboxyl group at other end.

 

steps

Step by step

Solved in 3 steps

SEE SOLUTIONCheck out a sample Q&A here
Blurred answer
Knowledge Booster
Genomics
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
  • SEE MORE QUESTIONS
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:
9780134580999
Author:
Elaine N. Marieb, Katja N. Hoehn
Publisher:
PEARSON
Biology 2e
Biology 2e
Biology
ISBN:
9781947172517
Author:
Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:
OpenStax
Anatomy & Physiology
Anatomy & Physiology
Biology
ISBN:
9781259398629
Author:
McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:
Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:
9780815344322
Author:
Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:
W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:
9781260159363
Author:
Martin, Terry R., Prentice-craver, Cynthia
Publisher:
McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Inquiry Into Life (16th Edition)
Biology
ISBN:
9781260231700
Author:
Sylvia S. Mader, Michael Windelspecht
Publisher:
McGraw Hill Education
SEE MORE TEXTBOOKS