low is a diagram of an assay you learned a lot about in class. In the third image, what is the little purple ball near the top supposed to represent? 4 Analyte a patient sample An enzyme A substrate A virus An antibody
Q: Please help Why did we use nanoparticles?
A: Nanoparticles are the techniques which are used in the biotechnology which used to identify the gene…
Q: In biotechnology, gene cloning is a very important technique. A vector is normally required to…
A: Cloning takes into account the formation of numerous copies of genes, articulation of genes, and…
Q: Experiment: Bradford protein assay give the answers (4-5 lines) of review questions in the end. the…
A: The proteins are formed by the polymerization of amino acids. Thus the amino acids are proteins that…
Q: Genetically engineered human insulin, human growth hormone, and human clotting factor VIII are made…
A: Answer is c.) transgenic bacteria.
Q: The PCR technique requires a DNA polymerase from an organism that can endure high heat, such as…
A: PCR is referred to as polymerase chain reaction. It was discovered by a biochemist Kary Mullis. It…
Q: Suppose there are three tubes containing following samples in the laboratory. The three tubes are…
A: DNA(deoxyribonucleic acid) is defined as the building block of life because it carries all the…
Q: Which is not needed to clone an animal? A)sperm for a donor animal B)nucleus from an adult animal…
A: Cloning is the process of producing individuals with identical or virtually identical DNA, either…
Q: How can we reuse an old biosensor with a new device
A: A biosensor is an analytical tool that works to analyze a sample when a particular target analyte is…
Q: Instructions In this image, the DNA fragments traveled from top to bottom. Use the drawpad to…
A: DNA is a double stranded helical molecule that is made up of repeating nucleotides. The nucleotides…
Q: Which of the following is NOT used in an in situ hybridization experiment for visualizing DNA? (CSLŐ…
A: Nucleic acid hybridization: It is a fundamental tool in molecular biology used to identify the…
Q: A piece of DNA is cut into four fragments as shown below. A solution containing the four fragments…
A: Electrophoresis is a technique used to separate charged particles like protein, RNA, and DNA. It is…
Q: Evaluate the gel provided below. Use the notes to help you read the gel: DNA is loaded in the wells…
A: Polymerase Chain Reaction is a method used to make millions of copies of a specific DNA sample.…
Q: Which of these is not considered a method of DNA extraction? organic filtration differential…
A: DNA (deoxyribonucleic acid) extraction is a procedure to isolate DNA from the cells. It is a method…
Q: Give an example for any biopharmaceutical produced by Recombinant DNA Technology (except insulin).…
A: Recombinant DNA technology is the specialized technique where a desired gene of interest is inserted…
Q: The technique that Rosalind Franklin used to take images of DNA is called NMR. O a. False O b. True
A: Nucleic acids are polynucleotides that contain many nucleotides that are bound by phosphodiester…
Q: GFP is fluorophore that: is used to observe fusion proteins in living cells is synthetic…
A: Answer is option a.) is used to observe fusion proteins in living cells.
Q: Why is an antibody used in this experiment?
A: Chromatin Immunoprecipitation (ChIP) is a type of technique based on immunoprecipitation and is…
Q: Is the figure below DNA or RNA? diesterase is an enzyme that breaks the covalent bond that connects…
A: Nucleic acids are polymers formed by diesters of phosphoric acid. Phosphodiester linkage in DNA is…
Q: if You have been transported to a DNA Lab by a mad scientist. The scientist hands you a gel…
A: DNA is one of the forms of nucleic acid and can be observed as a genetic material in most of the…
Q: Q. 1 kbps is same as ___________ Bps.
A: Bps means base pairs. Base pairing occurs in double-stranded DNA and RNA. DNA is deoxyribonucleic…
Q: Match the outcomes on the left with the laboratory steps on the right. ___ Harvest the cells…
A: Introduction: DNA isolation is a process of purification of DNA from samples using a combination of…
Q: All of the following are examples of materials that are bound by your purifying medium during the…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: A technique used to determine the tertiary structure of a protein is— high-performance liquid…
A: Proteins are macromolecules formed by amino acids. They are large size molecules, polymers of…
Q: Proteins are not suitable to be the genetic molecules within cells because they are large organic…
A: The genetic materials are responsible for the information that is carried out to offspring. Genetic…
Q: 3. Primer Design You are analyzing the
A: Primer is a short stretch of oligonucleotide which is designed to copy the gene sequence of interest…
Q: What is the implication of the amount of nucleic acid in cells for diagnostic testing or forensic…
A: * Nucleic acid detection is important technique to detect the detect the specific nucleotide…
Q: Which plate could represent the results of the transformation experiment positive control plated on…
A: Transformation can be defined as the process in which the plasmid of the bacteria is replicated. It…
Q: A piece of DNA is cut into four fragments as shown below. A solution containing the four fragments…
A: Gel electrophoresis is a technique used to separate different pieces of DNA on the basis of their…
Q: In biotechnology procedures, a(n) ____ is a nucleic acid fragment that is used to search for and…
A: In biotechnology procedures, a ___ is a nucleic acid fragment that is used to search for and…
Q: What are the important types MRNA molecule or genetic sequence that you can target to design a drug?…
A: Delivery person RNA (mRNA) could be a single-stranded RNA atom that's complementary to one of the…
Q: When you have a recombinant organism, it generally has genetic information from? only a bacteria…
A: Recombinant organism – An organism that contains a different combination of alleles from either of…
Q: 1. You are working as a CSI analyst. You collected DNA at a crime scene that is from the suspect but…
A: If the collected DNA at the crime scene is from the suspect but don’t have enough to run a test to…
Q: The sample furthest to the left contains the DNA size standards. What is the purpose of this sample?…
A: Gel electrophoresis is an analytical technique in which DNA fragments in a sample are separated…
Q: DNA can be electrophoresed. all cells have RNA. DNA polymerase will replicate any bacterial DNA. all…
A: PCR is short for Polymerase Chain Reaction.
Q: If the stop nucleotides were not added prior to loading the samples in the gel, what would the…
A: Gel electrophoresis is a molecular biology technique used to separate the fragments of nucleotide…
Q: In gel electrophoresis, DNA fragments migrate toward the _______electrode; the _______the fragment,…
A: Gel electrophoresis is a technique used to separate DNA molecules on agarose gel on the basis of…
Q: C. In order for your gel to run correctly, what side of the gel should you load the types of samples…
A: The technique of Gel electrophoresis is used or the separation of DNA fragments or macromolecules…
Q: Give information about the microchip that could control drugs invented by Robert Langer and Michael…
A: Designed by Microchips Biotech co-founders Michael Cima, the David H. Koch Professor of Engineering,…
Q: DNA is visualized during agarose gel electrophoresis by ______________ . the fact that DNA…
A: Agarose gel electrophoresis is a process of separation of DNA on the basis of mass and charge of…
Q: DNA is genetic material Prove it with the help of Hershey and Chase experiment. Draw the diagram of…
A: In this question, we have to explain the process of Hershey and chase experiment.
Q: A probe is a full section of DNA or RNA that has been labeled with a tracer. True False
A: DNA or RNA probe are nothing but the stretches of single stranded DNA or RNA which are labelled with…
Q: If you were going to design a drug to fight a virus, what would be likely targets for the drug…
A: Drug design, often referred to as rational drug design or simply rational design, is the inventive…
Q: DNA RNA Protein Gel electrophoresis Transfer to paper DNA* CDNA* Antibody* Add probe Image specific…
A: The image above shows DNA / RNA / protein are transferred to nitrocellulose membrane paper known as…
Q: Which of the following is true of the gel electrophoresis shown? A) the power source has not been…
A: Gel electrophoresis is a technique applied to separate fragments of DNA on the basis of their size…
Q: Please describe the CHIP assay. Why it is used? Please give examples Cells Lysis Cross-linking…
A: Chromatin immunoprecipitation (ChIP) assays This assay identifies the link between the genome and…
Q: In gel electrophoresis, DNA is made visible with Use the following information to answer the next…
A: Introduction The technique of gel electrophoresis is used to separate DNA fragments based on their…
Q: Which organism would be your first choice for transformation: a bacterium, earthworm, fish or mouse?…
A: In a process known as transformation, bacteria may pick up foreign DNA. In DNA cloning,…
Q: In which reagent is extracted DNA suspended to put it in solution? O Sodium dodecyl sulfate (SDS) O…
A: Introduction DNA extraction is a method to isolate DNA in a biological sample, which is done by…
Q: What are some similarities and differences in Bradford assay and Nanodrop (to obtain direct…
A: Protein quantification assays and their benefits and setback.
Step by step
Solved in 2 steps with 1 images
- Question 14 What is the vaccine delivery system used in the Moderna's COVID-19 vaccine? O Fentanyl patches O target-controlled infusion (TCI) devices O Lipid Nanoparticles O Transdermal drug deliveryQuestion 134 Which tests would be faster to perform? PCR or an ELISA test? both would take the same amount of time PCR ELISAQUESTION 5You are asked to recommend an antibiotic to treat potential pathogenicityt in an animal. Describe a method which will allow you to make this recommendation.
- QUESTION 1 You want to perform PCR on the CDNA of the spike gene from a SARS CoV-2 sample so that you can sequence it. Based on the sequence below, which of the following primer pairs would probably work for PCR of this gene? Spike gene Sequence: 5' ATGTTTATTTTCTTATTATTTTTTACTCTCACTAGTGGTAGTGACCTTGACCGGTGCACCACTTTTGATG ATGTTCAAGCTCCTAATTACACTCAACATACTTCATCTATGAGGGGGGTT TACTATCCTGATGAAATTTT. .. (it's really long so didn't post the whole thing.).TCTTGCTTTGTTGCATGACTAGTTGTTGCAGTTGCCTCAAGGGTGCATGCTCTTGTGGTTCTTGCTGCAA GTTTG ATGAGGATGACTCTGAGCCAGTTCTCAAGGGTGTCAAATTACATTACACATAA 3' Forward primer: 5' - CTC TCA CTA GTG GTA GTG ACC - 3' (Tm = 60.5 °C in a standard qPCR mix) Reverse Primer: 5' GGG TGT CAA ATT ACA TTA CAC ATA - 3' (Tm= 59.6 °C in a standard QPCR mix) Forward Primer: 5'- ATG TTT ATT TTC TTA TTA TT -3' (Tm=D 47.2 °C in a standard qPCR mix) Reverse Primer: 5'- GCA AGA ACC ACA AGA GCA TGC ACC -3' (Tm= 68 °C in a standard qPCR mix) Forward primer: 5' - CTC TCA CTA GTG GTA GTG ACC -3'…Question 6 Review virus replicate only in host cells. Match term and its description. Retroviruses use these enzymes to copy their RNA genome into [ Choose J DNA. The viral DNA that is integrated into the host genome is called a | Choose J These enzymes cut up foreign DNA that invades the bacteria cells. [ Choose JQUESTION 5 Based on the plasmid shown, what will you have to use to to distinguish and isolate the bacteria that successfully took up the plasmid? O Lactose O Tetracycline O Ampicillin O UV light to identify the glowing colonies O Xgal
- QUESTION 7 Which of the following best describes PCR? O a. A process through which amino acids can be joined to form proteins O b.A reaction whereby millions of target genes can be separated on an agarose gel O. A molecular tool that enables the amplification of specific DNA molecules in a test tube uBQUESTION 4 After you get your gene block, you do a restriction enzyme digest and ligation reaction with the plasmid/gene, so you can proceed to bacterial transformation! How does the plasmid get into the bacteria though? O You mix the plasmid in lipids with several other plasmids to make lentiviral vector that'll infect all the other cells. O The plasmid will be transmitted through a pilus to the other bacteria. O You make the bacteria chemically competent using calcium chloride, and then subject the cells to heat shock O Bacteria will naturally take up the plasmid so you don't need to worry about it.Question 3 Bacteria defend against phages by Natural selection favors mutation can not be recognized by virus. O all of these except DNA replication O restriction enzymes CRISPR-Cas system O DNA replication
- QUESTION 10 Which of the following is FALSE? O A. We have genetically engineered viruses, bacteria, plants and animals, including humans. OB. We have recently cloned and birthed the first human; she is 7 months old. OC. STR profiling is more accurate than DNA fingerprinting. O D. Gel electrophoresis is the technique used to do DNA fingerprinting.QUESTION 6 To verify the is indeed inside your plasmid, you'd like to do a colony PCR. But you need primers for your reaction. Which of the following primer pairs would probably work for verifying your insert is actually present in the plasmid? 5' ATGTTTATTTTCTTATTATTTTTTACTCTCACTAGTGGTAGTGACCTTGACCGGTGCACCACTTTTGATG ATGTTCAAGCTCCTAATTACACTCAACATACTTCATCTATGAGGGGGG TTTACTATCCTGATGAAATTTT (Very long, but a bunch of nucleotides her e).... TCTTGCTTTGTTGCATGACTAGTTGTTGCAGTTGCCTCAAGGGTGCATGCTCTTGTGGTTCTTGCTGCAA GTTTGATGAGGATGACTC TGAGCCAGTTCTCAAGGGTGTCAAATTACATTACACATAA 3' Forward: 5' GGT AGT GAC CTT GAC CGG 3' Tm= 59.8 O A. Reverse: 5' CAA ATT ACA TTA CAC ATA A 3' Tm= 47.4 Forward: 5' ATG TTT ATT TTC TTA TTA TTT 3' Tm= 47.1 C O B. Reverse: 5' TAT GTG TAA TGT AAT TTG ACA CCC 3' Tm3 58.4 Forward: 5' GGT AGT GAC CTT GAC CGG 3' Tm3 59.8 OC. Reverse: 5' GTG TAA TGT AAT TTG ACA CCC TTG 3' Tm: 59.4 Forward: 5' GGT CAC TAC CAC TAG TGA GAG 3' 59.4 C O D. Reverse: 5' GTG TAA TGT AAT TTG ACA CCC TTG…QUESTION 8 Check all the statements that are TRUE regarding 16S or ITS (microbiome) illumina (NGS) sequencing vs. whole genome illumina (NGS) sequencing. O A. You don't need to trim the reads for 16S sequencing, but you do for whole genome sequencing. O B. Whole genome sequencing files will have more reads in them because genomes are bigger than 165 amplicons. O C. The read alignment and contig assembly steps would probably be harder for whole genome sequencing. O D. The 165 molecules being sequenced are always DNA, while for whole genome sequencing they could be RNA or DNA going into the illumina sequencer. O E. NGS for 16S and whole genome sequencing can both use sample indexes/barcodes to maximize efficiency. O F. Whole genome sequencing doesn't necessarily require you to know any of the sequences/targets before hand to design specific primers for.