Leu-Glu-Glu-Val-Phe-Ser-Gln-Leu-Cys-Thr-His-Val-Glu-Thr-Leu-Lys a) Circle all of the hydrophilic amine acid residues. b) Box in all of the hydrophobic amino acid residues. c) The sequence forms an alpha helix. Create a model of the peptide on the alpha helix wheel below. Leucine has been placed for you at 0°. Continue placing the amino acids clockwise around the wheel. Each amino acid rotates by 100°. d) Add all of the circles and boxes to the amino acids around the wheel. e) Label the sections of the alpha helix that are hydrophilic and hydrophobic.

Leu-Glu-Glu-Val-Phe-Ser-Gln-Leu-Cys-Thr-His-Val-Glu-Thr-Leu-Lys a) Circle all of the hydrophilic amine acid residues. b) Box in all of the hydrophobic amino acid residues. c) The sequence forms an alpha helix. Create a model of the peptide on the alpha helix wheel below. Leucine has been placed for you at 0°. Continue placing the amino acids clockwise around the wheel. Each amino acid rotates by 100°. d) Add all of the circles and boxes to the amino acids around the wheel. e) Label the sections of the alpha helix that are hydrophilic and hydrophobic.

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

Use the following information to answer the next question. The DNA strand shown below is thought to contain the genetic code for part of an enzyme B-galactosidase which is involved in lactose metabolism. (Read the DNA beginning at the left.) -A-T-A-T-G-G-G-G-C-A-T-G The second amino acid coded from the section of DNA for B-galactosidase is Select one: a. thymine b. tryptophan c. serine d. threonine
Reverse translate the sequence of insulin pasted below:MALWMRLLPLLALLALWGPDPAAAFVNQHLCGSHLVEALYLVCGERGFFYTPKTRREAEDLQVGQVELGGGPGAGSLQPLALEGSLQKRGIVEQCCTSICSLYQLENYCNUse the webserver listed here:https://www.ebi.ac.uk/Tools/st/emboss_backtranseq/Please optimize the codons for Homo sapiens or Escherichia coli. Are the DNA sequences different?
Listed below are five amino acids. Use the genetic code to determine the exact codon for each amino acid. A point mutation at the genetic level in each codon results in the change indicated. For each mutation, indicate whether it is due to a transition or a transversion, and then indicate the effect of each mutation at the protein (amino acid level) (i.e. silent, nonsense, missense). In addition, Please note, each of the three lines above an amino acid represents a single RNA base. For example, when you look at the codon chart AUG would stand for Met (methionine) Lys 1 Glu Ile 3 Stop Ile 4.
A polypeptide is cleaved into peptides by treatment with trypsin and cyanogen bromide, and then the peptides are purified and sequenced. The sequences of the peptides are shown below. Trypsin peptides Cyanogen bromide peptides Based on sequences of the overlapping peptides generated by treatment with trypsin and cyanogen bromide (shown above), which of the following peptides represents the N-terminus of the original polypeptide? A. T-1 B. T-4 C. C-2 D. C-4 T-1 FENYAT-2 ELIMVPKT-3 NFEEGSKT-4 ITGLAIHQKT-5 GSMDPVALMTLR C-1 DPVALMC-2 VPKGSMC-3 ITGLAIHQKELIMC-4 TLRNFEEGSKFENYA
Answer the following questions based on the structure of the following peptide and the information in the attached table of enzyme activities. M-F-V-W-E-Q-A-P-S-P-L Subjecting this peptide to trypsin would result in OA Met-Phe-Val-Trp-Glu-Gin-Ala-Pro-Ser-Pro-Lys Met-Phe-Val-Trp-Glu-Gin-Ala-Pro-Ser-Pro-Leu OB. Met-Phe-Val-Trp-Glu-Gin-Arg-Pro-Ser-Pro-Leu OC. D. Met-Phe-Val-Trp-Glu-Gin-Arg and Pro-Ser-Pro-Lys O E. Met-Phe-Val-Trp and Glu-Gin-Arg-Pro-Ser-Pro-Leu
please answer all parts with good explanation and clear answer
This question refers to the mRNA sequence below: 5'-CCGUAUGCAUUUCGGACUUAGUAAGGACUGACAUAA-3' What is the third amino acid in the protein formed from this mRNA? Fill in the blank with the name of the correct amino acid and nothing else so that Moodle can grade your question correctly.
How many amino acids (aa) does your protein have? 1,106 aa 551 aa 1,367aa 508aa 1,210 aa Gene Sequence (5'-to-3'): atggaccacctcggggcgtccctctggccccaggtcggctccctttgtctcctgctcgctggggccgcctgggcgcccccgcctaacctcc cggaccccaagttcgagagcaaagcggccttgctggcggcccgggggcccgaagagcttctgtgcttcaccgagcggttggaggactt ggtgtgtttctgggaggaagcggcgagcgctggggtgggcccgggcaactacagcttctcctaccagctcgaggatgagccatggaag ctgtgtcgcctgcaccaggctcccacggctcgtggtgcggtgcgcttctggtgttcgctgcctacagccgacacgtcgagcttcgtgcccct agagttgcgcgtcacagcagcctccggcgctccgcgatatcaccgtgtcatccacatcaatgaagtagtgctcctagacgcccccgtgg ggctggtggcgcggttggctgacgagagcggccacgtagtgttgcgctggctcccgccgcctgagacacccatgacgtctcacatccgc tacgaggtggacgtctcggccggcaacggcgcagggagcgtacagagggtggagatcctggagggccgcaccgagtgtgtgctgag caacctgcggggccggacgcgctacaccttcgccgtccgcgcgcgtatggctgagccgagcttcggcggcttctggagcgcctggtcg gagcctgtgtcgctgctgacgcctagcgacctggaccccctcatcctgacgctctccctcatcctcgtggtcatcctggtgctgctgaccgtg…
Draw the peptide provided in its most protonated form. (Upload your answer.) Arg - Cys - Asp - Val
This question has been posted previously with parts A B and C already answered. Please focus on only D, E and F Provided is the question alongside with the added materials next to it. Thank you
Define downstream processing when producing a protein and list two examples. Cite it
Cystic fibrosis is genetic disease caused by mutations in the CFTR gene. The consequence of this is production of an abnormal transmembrane protein that is responsible for producing sweat, mucus, and digestive fluids. Please mention the process involved in protein production, whether or not those process(s) have occurred, and their end products.