INSTRUCTION: = IF BOTH STATEMENT ARE TRUE = IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS FALSE = IF FIRST STATEMENT IS FALSE WHILE SECOND STATEMENT IS TRUE = IF BOTH STATEMENTS ARE FALSE STAMENT 1: Heterogenous RNA is a term that refers to mRNA that has not been processed STAMENT 2: If the %A of a bacteria is 20%, the amount of guanine is 30%   STAMENT 1: A frameshift mutation involves a change in the reading frame used in the translation of an mRNA STAMENT 2: The genetic code is specific because each codon specifies only for one amino acid   STAMENT 1: Binding of RNA primer to the DNA is the first step in the transcription cycle STAMENT 2: Translation refers to the synthesis of proteins using the information contained in mRNA

Q: Which of the following steps is NOT used in whole genome sequencing? Select one alternative: O…

A: WGS stands for whole-genome sequencing and is a method for examining complete genomes. Identifying…

Q: Question:- Can you please explain the general rule on how to manually align these sequence?? i am…

A: DNA sequencing is a technique for determining the exact sequence of bases (A, C, G, and T) in a DNA…

Q: Using the Concord Consortium interactive, observe how mutations can affect protein formation and…

A: Introduction A mutation is a change in an organism's DNA sequence. Mutations can be caused by…

Q: Choose any/all that apply to mRNA processing in eukaryotes. The "starter/initiator" methionine codon…

A: The production of a polypeptide chain (protein) from the genetic codon present in the mRNA…

Q: What are the functional consequences of this deletion for lilP mRNA transcription and translation?…

A: Introduction :- A deletion mutation is a type of genetic mutation that involves the loss of one or…

Q: Given the DNA strand with sequence 5' AUGGAGGAUGGCCAGUCAAUUUGA 3' match the various mutations to the…

A: Codon is a sequence of three nucleotides that corresponds to a specific amino acid. Codons encode…

Q: 1. Indicate the objective of this method..... of the DNA 2. Pick out the donor...... & the…

A: Hello. Since your question has multiple sub-parts, we will solve the first three sub-parts for you.…

Q: PCR and Gene Cloning Basics Question: What are 2 possible roles of CaCl2 in the transformation…

A: Introduction: Polymerase Chain Reaction, or PCR, is a scientific method for amplifying a particular…

Q: When completing genome sequences, contiguous sequences, or contigs are important intermediates.…

A: * A contig refers to series of overlapping DNA sequences  that are used to make  physical map which…

Q: Situational task: As a result of intoxication, enzymes that provide splicing are not synthesized in…

A: Introduction :- Splicing is the process by which introns (non-coding regions) are removed from a…

Q: I’m kinda confused on what to study for the test and what questions are gonna be on there but this…

A: In the given slide , they wants to explain you about bacterial chromosome which is different from…

Q: Draw, or fully describe all parts of the CRISPR Cas complex as it identifies and then cuts DNA.…

A: The CRISPR-cas system is an adaptive immune system of bacteria and archaea, which protects the…

Q: A. The insertion shifts the reading frame to the right .The deletion frameshifts the reading frame…

A: *NOTE: Kindly repost for other questions Dear Student as per the guidelines we are supposed to…

Q: The following RNA sequence represents a small messenger which can be translated in a prokaryotic…

A: The first step in translating an RNA sequence into a protein is to divide the sequence into codons,…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: Question: Genetically modified animal that might be approved for human consumption is a super…

A: Introduction  CRISPR stands for Clustered Regularly Interspaced Short Palindromic Repeats.  This is…

Q: Recall from the central dogma that DNA codes for mRNA, which then codes for protein. Also recall…

A: As per the central dogma of molecular biology, the genetic information for protein synthesis is…

Q: What are the stop/nonsense codons?

A: Hi! Thank you for the questions. As you have posted multiple questions, I will be answering the…

Q: How long is the polypeptide produced from the following mRNA transcript?…

A: We can find this answer using a codon chart- 5-UCA UGC UUG GAC UCA AGU CUA CGU GAA U-3' As each mRNA…

Q: Which of the following terms refer to the case when a mutation results in a partial loss of the…

A: Mutation is an alteration in the DNA sequences of the genome of an organism due to environmental…

Q: Which amino acid would bind if the mRNA read.... AGG? Ala (A) Ser (S) G A Lys (K) Asp (D) U ← Asn…

A: Once mRNA is produced, by transcribing and processing the information contained in the nucleotide…

Q: Remodeling complexes use the energy from ATPhydrolysis to change the position of…

A: Chromatin remodeling is the structural modification of chromatin to allow access of condensed…

Q: = IF BOTH STATEMENT ARE TRUE = IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS FALSE = IF FIRST…

A: Q1. STAMENT 1: If 3’ ATTG 5’ is transcribed, the complementary strands is 5’ UAAC 3’ STAMENT 2:…

Q: plication. However, he has gotten into an argument with a new student in the lab. The student thinks…

A: The protein assembly at the replication's origin where there is a beginning of DNA Synthesis called…

Q: fluctuating Proteolytic cleavage is used to inactivate repressors in an essentially process, such as…

A: Proteolytic cleavage is basically the process of breaking the peptide bonds between amino acids in…

Q: Molecular Biology (Biol-L211) Dr. Nole Central Dogma Practice - Processes The general flow of…

A: The replication, transcription and translation are the very important processes in cell biology that…

Q: Question : The peptide bond : (Indicate the right answer) : A- Is a hydrophobic bond. B- Is formed…

A: The peptide bond is also similar to an amide bond that helps to join two amino acids and make a…

Q: The following is a polypeptide from a wild type organism: met – ser – tyr – his – trp – arg – ser –…

A: Mutation is any sudden change resulting in an abnormal structure.  The given polypeptide chain is,…

Q: Topic: Splicing a. What is the big picture of splicing and what is the importance of this concept…

A: RNA splicing is a process that cuts the, non-coding sequences of genes (introns) from pre-mRNA and…

Q: à sequence of eukaryotic DNA containing a hypothetical gene. The base that is first (at the 5' end)…

A: The genetic code is a system of rules that living cells use to interpret the information contained…

Q: 9. A single nucleotide addition and a single nucleotide deletion approximately 15 bases apart in the…

A: Nucleotides are  the building blocks of nucleic acids that are DNA and RNA. It is made up of sugar…

Q: INSTRUCTION: = IF BOTH STATEMENT ARE TRUE = IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS…

A: DNA is also called deoxyribonucleic acid. DNA act as the genetic material in most organisms. RNA is…

Q: explanation

A: To restore a protein's normal function after a frameshift mutation, the reading frame must be…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: 1) Develop an analogy for the processes researchers use to make changes to DNA. In analogy, explain…

A: Nucleic acids are macromolecules composed of nucleotides (sugar, phosphate, and nitrogen base) bound…

Q: Let's Apply In each of the following DNA sequences, write on your answer sheet the corresponding…

A: DNA ( Deoxyribonucleic acid ) is two stranded helical structure which act as genetic material in…

Q: In the next experiment, MCF-7 cells were treated or not with indibulin and the effect of this drug…

A: Question: Comment Figure 4 globally (make the parallel between the left images and the graph on…

Q: Practice test

A: Mutations in RNA sequence:a. Frameshift Mutation (2 marks):This mutation alters the reading frame by…

Q: Enhancer sequences may be very far from the genes they affect but they are always upstream of the…

A: Enhancer sequence : These are regulatory DNA sequences, when these are bound by transcription…

Q: Assignment 9: Transcribing and Translating a Protein Activity  5.4.1 Synthesis of a Protein: A…

A: 1. Sequence A TCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence…

Q: If one strand of the DNA double helix consists of T-C-G-A-T-G-T-A, what is the sequence of the…

A: Introduction DNA ( Deoxyribonucleic acid) and RNA( ribose nucleic acid). These are the nucleic acids…

Q: Please answer them correctly - Please answer all of them, they are connected. MUTATION Fill in the…

A: Introduction DNA is an organic molecule that includes genetic information as well as instructions…

Q: STAMENT 1: Transfer RNA is the RNA that contains anticodon STAMENT 2: The tail added to an mRNA to…

A: Hello dear student you have asked more than one different questions in a single slot, we could only…

Q: Biol370 - Assignment #2 – Spring 2020: Replication - Transcription - Translation Due 3/10/2020…

A: To fill the table

Q: 1.What is the official genename of the gene? Do you have another names?

A: The gene is formally represented by the suggested name. However, a particular gene has frequently…

Health Epidemiology

Health is an essential factor for all human beings. For all humans, health is a critical factor. An individual's ability to meet life's challenges and retain his or her capacity for optimal functioning is reflected in his or her condition of health. This needs the physical, mental, and biological parts of one's constitution to maintain a degree of functioning that has a favorable influence and support for one another.