INSTRUCTION: = IF BOTH STATEMENT ARE TRUE = IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS FALSE = IF FIRST STATEMENT IS FALSE WHILE SECOND STATEMENT IS TRUE = IF BOTH STATEMENTS ARE FALSE STAMENT 1: Heterogenous RNA is a term that refers to mRNA that has not been processed STAMENT 2: If the %A of a bacteria is 20%, the amount of guanine is 30%   STAMENT 1: A frameshift mutation involves a change in the reading frame used in the translation of an mRNA STAMENT 2: The genetic code is specific because each codon specifies only for one amino acid   STAMENT 1: Binding of RNA primer to the DNA is the first step in the transcription cycle STAMENT 2: Translation refers to the synthesis of proteins using the information contained in mRNA

Q: Which of the following steps is NOT used in whole genome sequencing? Select one alternative: O…

A: WGS stands for whole-genome sequencing and is a method for examining complete genomes. Identifying…

Q: Define the transcription unit. How does it differ from the gene? Describe how you would determine…

A: Succession of nucleotides in DNA that codes for a solitary RNA particle, alongside the arrangements…

Q: Procedure 1. 2. 3. 4. 5. 6. Fill in the data table below. Complete column B by writing the correct…

A: Process of synthesis of RNA from DNA is known as transcription. As the colum A in the table…

Q: Biochemistry: Site-directed mutagenesis, in which individual amino acid residues are replaced with…

A: Enzyme activity is used to assess the catalytic activity of an enzyme. One enzyme unit (U) is the…

Q: Processing of primary mRNA transcripts in eukaryotic cells DOES NOT involve which of the following?…

A: Ans:-C 1.What end does the poly A tail attach to? 3′ end A poly (A) tail is added to the 3′ end of…

Q: Choose any/all that apply to mRNA processing in eukaryotes. The "starter/initiator" methionine codon…

A: The production of a polypeptide chain (protein) from the genetic codon present in the mRNA…

Q: Given the DNA strand with sequence 5' AUGGAGGAUGGCCAGUCAAUUUGA 3' match the various mutations to the…

A: Codon is a sequence of three nucleotides that corresponds to a specific amino acid. Codons encode…

Q: Which example is describing a "nonsense" mutation? O The normal amino acid sequence of a protein is…

A: Nucleic acids are large molecules made up of nucleotides that help to build proteins and to express…

Q: 63 What is the mRNA transcribed from the template strand of DNA shown below? 5' TATGGC 3' Select an…

A: The given template strand is 5' TATGGC 3'

Q: Please help with all parts of A, B, C, D 2. You are studying the function of a messenger RNA named…

A: Understanding the genetic processes that take place in cells requires a thorough understanding of…

Q: Draw, or fully describe all parts of the CRISPR Cas complex as it identifies and then cuts DNA.…

A: The CRISPR-cas system is an adaptive immune system of bacteria and archaea, which protects the…

Q: When large genomes are sequenced, which of the following is true? Group of answer choices   The…

A: Genome is defined as the total complete set of an organism's DNA where it contains of all the…

Q: The following RNA sequence represents a small messenger which can be translated in a prokaryotic…

A: The first step in translating an RNA sequence into a protein is to divide the sequence into codons,…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: Question: Genetically modified animal that might be approved for human consumption is a super…

A: Introduction  CRISPR stands for Clustered Regularly Interspaced Short Palindromic Repeats.  This is…

Q: 4) Consider three different kinds of human libraries: a genomic library, a brain cDNA library, and a…

A: Genomic deoxyribonucleic acid (gDNA) is representative of the chromosomal DNA present in the cells…

Q: please help solve

A: CRISPR-Cas system is the naturally present defense system in the prokaryotes.

Q: A) Which of the transcription components must be present during the preincubation to keep the…

A: The term "chromatin" describes the DNA and protein mixture that makes up the chromosomes found in…

Q: Match the following (most appropriate combinations): Gel filteration chromatography Electrophoresis…

A: 1) Gel filtration chromatography - separation of proteins in a column based on size. In this type of…

Q: plication. However, he has gotten into an argument with a new student in the lab. The student thinks…

A: The protein assembly at the replication's origin where there is a beginning of DNA Synthesis called…

Q: Continuing from the question above. You are able to correctly modify the blood stem cells and return…

A: Sickle cell anemia is majorly due to missense mutation which results in valine substitution in place…

Q: Topic: Splicing a. What is the big picture of splicing and what is the importance of this concept…

A: RNA splicing is a process that cuts the, non-coding sequences of genes (introns) from pre-mRNA and…

Q: à sequence of eukaryotic DNA containing a hypothetical gene. The base that is first (at the 5' end)…

A: The genetic code is a system of rules that living cells use to interpret the information contained…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: explain why it is far less important for Primase to have proofreading activity than it is for DNA…

A: DNA proofreading is error correction process, in which DNA polymerase checks the each nucleotide…

Q: 1) Develop an analogy for the processes researchers use to make changes to DNA. In analogy, explain…

A: Nucleic acids are macromolecules composed of nucleotides (sugar, phosphate, and nitrogen base) bound…

Q: Let's Apply In each of the following DNA sequences, write on your answer sheet the corresponding…

A: DNA ( Deoxyribonucleic acid ) is two stranded helical structure which act as genetic material in…

Q: You would like to design a method to treat the most common mutation that causes sickle cell anemia…

A: Precise genome editing is a potential technique for discovering causative genetic variations and…

Q: Practice test

A: Mutations in RNA sequence:a. Frameshift Mutation (2 marks):This mutation alters the reading frame by…

Q: A. The insertion shifts the reading frame to the right. The deletion frame shifts the reading frame…

A: DNA is two stranded helical structure which act as template for making of mRNA. It also functions as…

Q: Assignment 9: Transcribing and Translating a Protein Activity  5.4.1 Synthesis of a Protein: A…

A: 1. Sequence A TCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence…

Health Epidemiology

Health is an essential factor for all human beings. For all humans, health is a critical factor. An individual's ability to meet life's challenges and retain his or her capacity for optimal functioning is reflected in his or her condition of health. This needs the physical, mental, and biological parts of one's constitution to maintain a degree of functioning that has a favorable influence and support for one another.