Imagine a protein that normally resides and functions in the ER lumen. What would be the fate of this protein in a biological cell which has its SRP gene mutated such that it does not recognize the ER signal sequence? The protein would reside in the nucleus. O The protein would reside in the ER. O The protein would reside in the cytoplasm. The protein would reside in the nucleus.
Q: A protein was recently discovered to be located in the nucleus. However, it is uncertain whether…
A: The most important and basic knowledge that we should remember here in-order to understand the…
Q: This figure below shows the organization of a protein that will end up in the ER membrane . The…
A: Translocation: The term translocation is the process or a genetic change that occurs when a piece of…
Q: Suppose that you joined a group of scientists working on a protein which has nuclear localization…
A: Nuclear transport alludes to the mechanisms by which particles get across the nuclear membrane of a…
Q: You study the expression of the hexose kinase gene and capture the following electron micrograph of…
A: During mutation, there is a change in the overall sequence of the gene, which can result in a change…
Q: Which of the following would you expect to happen if there were a mutation in the Iron Response…
A: Sequences of mRNA called called (IREs) are contained within the mRNA sequences that code for…
Q: When high levels of unfolded proteins are detected in the endoplasmic reticulum (ER), a eukaryotic…
A: Chaperone proteins are group of proteins which causes stabilization of unfolded proteins which helps…
Q: Which best describes the fate of this protein?
A: The correct answer to this question is: The protein remains in the cytosol
Q: Imagine that you are working with DNA sequences of membrane proteins) and have the technology to…
A: Protein synthesis can be mediated by membrane free ribosome or membrane bound ribosome. Actually the…
Q: What region would provide cell type-specific expression of genes? region What site would…
A: The mRNA is given in the figure. The mRNA undergoes the process of translation to produce protein.
Q: What will happen if both SRP54 and SRalpha are bound to GTPgammaS instead of GTP? SRP54 and SRalpha…
A: SRP54 and SRalpha are proteins involved in the process of protein synthesis and folding in the…
Q: What are the two families of small GTP-binding proteins that are involved in determining the final…
A: Small GTP-binding proteins, often known as G proteins, are found in eukaryotes and are organized as…
Q: When high levels of unfolded proteins are detected in the endoplasmic reticulum (ER), a eukaryotic…
A: Genes are DNA segments that code for specific proteins.
Q: TTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGTAATATGGGGATGCACTATC…
A: Transcription is the process of production of an RNA segment from the strand of a gene sequence. The…
Q: Nucleation of straight, single line microfilaments is mediated by which of the following? Rho GTPase…
A: The nucleation of actin filaments is a tightly regulated process that involves several proteins.…
Q: If Sar1 is inserted into the ER membrane: O It is bound to GDP and recruits COPII coat proteins O It…
A: Sar1 is a small GTPase that plays a key role in the formation of COPII vesicles, which transport…
Q: A KDEL sequence is necessary for ... Select an answer and submit. For keyboard navigation, use the…
A: According to certain theories, the KDEL receptor controls COPI transport. The development of COPI…
Q: You are studying Protein X which plays a role in promoting the G1/S phase transition in eukaryotic…
A: The G1 phase of the cell cycle is that phase that occurs after the cell division and just before the…
Q: structure of DNA from the level of a gene to a condensed mitotic chromosome. At each of the four…
A: Gene expression is the process in which transcription is followed by translation. In transcription…
Q: Imagine a protein that normally functions in the nucleus. If you added an ER signal sequence to the…
A: The translation of proteins occurs by membrane free ribosomes or by membrane bound ribosomes. The…
Q: Hac1 is another chaperone protein that is up-regulated in response to unfolded proteins in the ER.…
A: Introduction Proteins are essential biomolecules that play a wide range of roles in controlling…
Q: What would most likely occur to nuclear-cytoplasmic shuttling if the intrinsic GTPase activity of…
A: RAN is ras associated nuclear protein which is GTPase, a regulator of cell cycle. Ran is important…
Q: engineered a version of the Bax protein that is functional, but is mislocalized to the plasma…
A: Apoptosis is an internal cellular mechanism of cell death to protect healthy cells. It results in…
Q: A current focus of molecular medicine is to trigger or promote apoptosis of specific cells. several…
A: Cancer is an uncontrolled division of cell that has a defunct apoptosis mechanism. Usually, when…
Q: that binds Fsh3 is a receptor tyrosine kinase (RTK) and there are numerous fish tumor cell lines…
A: Answer. Enzyme-linked receptors are a second major type of cell surface receptors. Like…
Q: Which of the following small GTP-binding proteins does NOT play a role in cell migration during…
A: Introduction : Cell migration is the movement of a cell or group of cells for regeneration,…
Q: The Iron Response Factor (IRF) protein regulates production of both the iron transport protein…
A: Iron regulating factor (IRF) is a cytoplasmic protein that detects intracellular iron levels and…
Q: You are studying Protein X which plays a role in promoting the G1/S phase transition in eukaryotic…
A: G1/S phase transition is cell cycle stage between G1 phase and S phase. This transition phase…
Q: magine that you created a cell that over-expresses a truncated version of its extrinsic pathway…
A: The outcome would have no effect on extrinsic apoptosis.
Q: Determine how many domains and list the residues in each domains (ei. 1-230, 1-120) Vertebrate Ca…
A: The following table explains the answer.Protein-4 VCA( vertebrate Ca 2+ dependent cell adhesion…
Q: When the gene encoding a certain cellular kinase is deleted, the resulting mutant cells arrest in…
A: Cellular kinases are enzymes that catalyze the transfer of phosphate groups from one substrate to…
Q: Below is a model of a signal transduction pathway that results in the transcribing of mRNA: Receptor…
A: Signal transduction pathways are complex networks of molecular events that relay extracellular…
Option c
The protein would reside in the cytoplasm
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Imagine a protein that normally functions in the nucleus. If you added an ER signal sequence to the N-terminal end of the gene that expresses this nuclear protein (through genetic manipulation), what would be the fate of the expressed protein? The protein would reside in the cytoplasm. The protein would reside in the cell membrane. The protein would reside in the ER. The protein would reside in the nucleus.A KDEL sequence is necessary for ... Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a lysosomal enzymes to reach the lysosome. b transmembrane proteins to be targeted to the plasma membrane. с binding to KDEL receptors and transport through the trans-Golgi network. the transport of resident ER proteins from the Golgi to the ER.Hac1 is another chaperone protein that is up-regulated in response to unfolded proteins in the ER. You detect amounts of Hac1 mRNA and protein in the absence and presence of unfolded protein in the ER of a eukaryotic cell as shown in the figure below. b. Describe two specific biological processes that the cell could regulate in order to increase the amount of Hac1 protein. Briefly explain your answer using the information from figure C & D. Hac1 MRNA expression Hac1 protein expression Unfolded proteins in ER No unfolded No unfolded proteins In ER Unfolded protelns in ER proteins in ER
- Given the following schematic for a gene and its associated regulatory regions, answer the following questions by placing the correct letter in the provided blanks please put in the correct letter for the questions What region would provide cell type-specific expression of genes? region What site would significantly increase gene expression rates? = region What region or regions of this gene’s coding sequence are expressed as amino acids = regionWhen high levels of unfolded proteins are detected in the endoplasmic reticulum (ER), a eukaryotic cell responds by increasing the gene expression of chaperone proteins, which help proteins to fold correctly. BiP is a chaperone protein. You detect amounts of BiP mRNA and protein in the absence and presence of unfolded protein in the ER of a eukaryotic cell as shown in the figure below. a. Describe two specific biological processes that the cell could regulate in order to increase the amount of BiP protein. Briefly explain your answer using the information from figures A & B. A BİP MRNA expression В BiP protein expression No unfolded Unfolded No unfolded Unfolded proteins in ER proteins in ER proteins in ER proteins in ERWhen high levels of unfolded proteins are detected in the endoplasmic reticulum (ER), a eukaryotic cell responds by increasing the gene expression of chaperone proteins, which help proteins to fold correctly. BiP is a chaperone protein. You detect amounts of BiP mRNA and protein in the absence and presence of unfolded protein in the ER of a eukaryotic cell as shown in the figure below. a. Describe two specific biological processes that the cell could regulate in order to increase the amount of BiP protein. Briefly explain your answer using the information from figures A & B. A BİP MRNA expression BiP protein expression No unfolded Unfolded No unfolded Unfolded proteins in ER proteins in ER proteins in ER proteins in ER
- Control of gene expression in eukaryotic cells occurs at which level(s)? a. only the transcriptional level b. epigenetic and transcriptional levels c. epigenetic, transcriptional, and translational levels d. epigenetic, transcriptional, post-transcriptional, translational, and post-translational levelsThis figure below shows the organization of a protein that will end up in the ER membrane . The N-term and C-termini of the protein are labeled. Boxes 1,2, and 3 represent membrane spanning sequences. Non-membrane-spanning regions are labeled X, Y and Z. Once this protein is fully translocated , where will region Z end up? signal peptidase cleavage site NE O inserted in the ER membrane in the ER lumen O in the cytoplasm degraded by a signal peptidaseplease help
- Below is a model of a signal transduction pathway that results in the transcribing of mRNA: Receptor protein Transcription factor Phosphorylation cascade DNA mRNA What is the best description of what would happen if the phosphorylation cascade resulted in a phosphate being attached to the transcription factor? O mRN would not stop being transcribed from the DNA. O The phosphorylation cascade would continue to release excess phosphates. O mRNA would stop being translated from the DNA. O Receptor proteins would not bind to the signaling hormone.What will happen if both SRP54 and SRalpha are bound to GTPgammaS instead of GTP? SRP54 and SRalpha will always bind to the sec61 translocon, and ribosome will fail to translate proteins into the ER lumen SRP54 will never bind to SRP receptor, and ribosome will always translate proteins into the ER lumen SRP54 and SRalpha will always bind to the sec61 translocon, and ribosome will always translate proteins into the ER lumen SRP54 will never bind to SRP receptor, and ribosome will fail to translate proteins into the ER lumenImagine that you are working with DNA sequences of soluble proteins (not membrane proteins) and have the technology to genetically engineer/alter the existing sequence and you can express this particular protein in a yeast cell model. You also have the power to track and visualize where the genetically engineered proteins traffic in your model system. You engineer an ER signal sequence to the carboxyl-terminal end of a normally cytosolic protein. Which best describes the fate of this protein? O The protein is translocated through the ER membrane translocon channel, N' end first O The protein is translocated through the ER membrane translocon channel, C' end first The protein is degraded The protein remains in the cytosol