Which of the following traces the path of a protein from transcription to localization in the thylakoid membrane?

Q: Question 2

A: As it is given in the question, the second microbe that belongs to clostridium genus can develop…

Q: QUESTION 9 Prosthetic groups in the class of conjugated proteins known as glycoprotein are composed…

A: Conjugate protein has protein component as well as non-protein component joined together either by…

Q: question 3

A: 1. With age the collagen increases in the tissues. Collagen is stiff as compared to muscles.

Q: O Pr[A] Pr[B | A]

A: 6. Pr { A} Pr { B | A }

Q: 5. If the hypothetical restriction endonuclease CutVI were to recognize and cleave a circular piece…

A: A restriction endonuclease is an enzyme that recognize specific sequence present on DNA and cleaves…

Q: Question 11 Chordates typically have O a notochord. O radialcleavage. All of the choices are typical…

A: Answer: C (All of the choices are typical chordate features)

Q: Most hormones, such as peptide hormones, exert their effects by binding to cell- surface receptors.…

A: Hormones are involved in the signaling molecules which are produced by glands of the multicellular…

Q: 4. Calculate the yield of ATP when one mole of stearic acid is completely oxidized to CO, and H,O.

A: Biological lipids are a chemically diverse group of organic compounds which are insoluble or poorly…

Q: ain. 4. Comment the answer of GM seed companies: "We don't know really know. And we aren't going to…

A: Biotechnology refers to a group of technologies that are focused on gaining a better knowledge of…

Q: Ribosomal prote 4. Eukaryotic ribosomes have some similarities to prokaryotic ribosomes, but they…

A: Prokaryotic cell do not have membrane bound organelles however eukaryotic cells do have. Prokaryotic…

Q: 2. Is the Mueller-Hinton Agar (MHA) a complex or defined medium? Explain based on its composition.…

A: microorganisms are grown in laboratory using growth media . usually these media are having the…

Q: 1x GGCGAUGGGCAAUAAACCGGGCCAGUAAGC Identify the start codon, and determine the complete amino acid…

A: Translation is the process of synthesis of proteins from mRNA. Proteins are synthesized by adding…

Q: At what objective magnifications is it not OK to use the course focus adjustment? O A) 4X and 10X B)…

A: Microscope is an optical instrument which is used to enlarge and view microscopic objects.…

Q: 4 The complete genome of the simplest bacterium known, Mycoplasma genitalium, is a circular DNA…

A: Introduction-- Dna topoisomerase enzyme act to regulate Dna supercoiling by catalyzing the winding…

Q: Which of the following microscopy approaches would work best for imaging a large protein complex…

A: Microscope is an instrument which is used to magnify the size of an object. We can see smaller size…

Q: In a grain the highest amount of starch would be found in O endosperm O bran aleurone layer embryo…

A: A grain is any food made from rice, wheat, oats, cornmeal. Same examples are- pasta, bread,…

Q: 9. A researcher measured the absorbance of a sample of C. vulgaris and found it to be 0.05. What is…

A: Ans 9.Beer lambert's law states that there is direct linear relationship between the absorbance and…

Q: You are in the lab, and you wish to repeat Avery's experiments. Which of the following mixtures…

A: Avery, Macleod, and McCarty performed an experiment to prove what is the genetic material in living…

Q: Below is a portion of a bacterial chromosome that contains a gene. The promoter region and the +1…

A: Nucleic acid is a macromolecule that is exhibited inside the nucleus . It consists of DNA and RNA…

Q: 1. Identify the wave at the arrow. 2. What electrical event is indicated by the wave? 3. What is the…

A: Electrocardiography or ECG is the graphical representation of the heart's electrical activity. In…

Q: Adipocytes store fat in phospholipid-coated droplets in the cytosol. The protein perilipin is also…

A: Perilipin, also recognized as a protein associated with lipid droplets, is a protein that is…

Q: Shown are several single stranded DNA sequences written in the 5' to 3' direction. Which of the…

A: A hair pin structure will be formed due to internal base pairing in a DNA molecule.

Q: 4. If a parent cell has diploid number of 14 chromosomes prior to mitosis, how many will each…

A: In the cell duplication process known as mitosis, the parent cell divides into 2 daughter cells…

Q: The gain-of-function ANTP mutant in Drosophila has legs growing in the place of antennae. What is…

A: Hox genes are the genes which contain homebox sequence and these are responsible for the…

Q: Which of the following is FALSE regarding primase? It synthesizes primers on the leading and lagging…

A: Replication is the process during which DNA is replicated into the daughter DNA with the help of…

Q: All of the following are true about grasses except

A: Grasses are angiosperms.

Q: An arctic hare's coat color changes from white to brown each spring in response to a change in its…

A: Climate Change : Climate change refers to long-term shifts in temperatures and weather patterns.…

Q: Question 4

A: Antibiotics are the substance produced by one type of microorganism that are used against another…

Q: The concentration of solutes in Cell X is 13%, but Cell X contains no potassium or magnesium. CelI X…

A: Molecules move across the plasma membrane on the basis of the concentration gradient, from region of…

Q: 4. A closed-circular DNA molecule in its relaxed form has an Lk of 500. Approximately how many base…

A:

Q: Answer the above question for CutVI if the starting DNA were linear instead of circular.

A: Restriction enzymes are enzymes that identify specific sequences in DNA and cut DNA at or near these…

Q: You have a gene normally expressed in liver cells that you wish to express in a muscle cell. What…

A: Answer: GENE EXPRESSSION = When we select a gene and express in another stretch of DNA where the…

Q: Alkaliphiles are organisms that thrive in extremely basic environments. Which type of interaction(s)…

A: Alkaliphile is an extremophile that belongs to archae bacteria.

Q: Transmembrar the cell, and in chemical prope region a and re You are given te contents? Refer lodine

A:

Q: 4. One type of beetle found in fields where corn is grown can have either a grey outer shell or a…

A: In the given question- The allele for dominant trait (Grey outer shell) is G The allele for…

Q: 6. What are 3 stimuli that regulate animal cell division?

A: Different signals that enable optimal timing, coordination, and regulation of the process control…

Q: Covalent bonds can be formed in each of the following situations except between dCTP and dTTP in a…

A: A covalent bond is formed by sharing of electrons between two atoms. Examples of covalent bonds are…

Q: Read the statements below about membrane transport. Identify the statement that is true. The…

A: Thier are different mechanism of transport of molecule in the cell . Some use energy whike other…

Q: 6. There is evidence that a pesticide-producing organism continues to produce pesticide once it's…

A: The mainly used pesticides producing organism is Bacillus thuringiensis which widely used in the…

Q: 5) Suppose that 50% of the alleles at a specific locus are dominant (A), and the only other allele…

A: The principle that demonstrates the constant value of the genotypic frequency in every succeeding…

Q: When the pathogen Salmonella typhimurium infects mammalian cells, the host cell protease caspase-1…

A: Question :  When the pathogen Salmonella typhimurium infects mammalian cells the host cell protease…

Q: QUESTION 4 Which length of DNA fragment would move the fastest and farthest during an…

A: Gel electrophoresis is general lab techniques to determine the quality and quantity of DNA/RNA in…

Q: 4. In Wisconsin Fast plants, purple stems (P) are dominant to green stems (p). Plants can also be…

A: Chi square analysis is a statistical test to measure differences between observed and expected data.

Q: 2. (a) Consider Amino Acid Sequence 2. How is Amino Acid Sequence 2 different from Amino Acid…

A: The explanation is given below.

Q: Which of the following statement is true for inhalation? O Intrapulmonary pressure decreases and…

A: Respiration is the process of taking oxygen and releasing carbon dioxide outside. The breathing is…

Q: Which of the following is or are considered to be quality source(s) for fact finding when trying to…

A: Science, any system of knowledge that deals with the physical world and its phenomena and that…

Q: Why would you NOT expect a restriction endonuclease to exist that would recognize the site AAGGAA?

A: Note: The student asked to answer only question 4. Molecular biology is defined as that study…

Learning and memory

Learning is defined as a relatively permanent and irreversible adaptive change in behavior. It always results from experience. The ability of an organism to store and recall the effects, sensations, and knowledge gained through learning and experience is called memory.