Identify the correct mRNA that will be produced from this NON-TEMPLATE or CODING strand: TAG CCG ATG CAA GTG a.AUG CCG UAG CUU GAG b.AUC GGC UAC GUU CAC c.ATC GGC TAC GTT CAC d.UAG CCG AUG CAA GUG

Q: What type of mutation occurred to produce the abnormal sequence (nonsense or missense)? Explain your…

A: A mutation is a change in a DNA sequence.

Q: Compare the two mRNA sequences below. AUAUUCGGCAAUCCG AUAUUCCGCAAUCCG This change could be the…

A: Messenger RNA or mRNA is single stranded RNA which acts as template for the synthesis of amino acids…

Q: Which of the following RNA molecules is to the sequence: 5' AGGCTCAAGCGT - 3'? complementary O a.…

A: RNA is a single stranded nucleic acid which plays a key role in gene expression and protein…

Q: a. The promoter is to the right so transcription goes right to left. b. This sequence 5’…

A: Transcription is is a cellular process by which DNA can produce RNA by the use of RNA polymerase…

Q: . Show (on the image) 3 steps that must be taken to produce a mature mRNA molecule from this pre-…

A: The genetic material which is the DNA undergoes the process of replication to produce exact copies…

Q: 1. For this gene (I marked the +1 site) a. Identify the promoter, template, and coding strand b.…

A: Promoter is a region on the DNA where RNA polymerase enzyme binds for the process of transcription.…

Q: a. Show (on the image) 3 steps that must be taken to produce a mature mRNA molecule from this pre-…

A: RNA Splicing: A newly created precursor messenger RNA (pre-mRNA) transcript is converted into a…

Q: Bacterial RNA that can act both as an mRNA and a tRNA Group of answer choices a.Micro RNA b.Guide…

A: The gene that a eukaryotic cell turns "on" to a great extent decide its personality and properties.…

Q: The following sequence has been mutated as follows. What type of mutation is this? Original DNA: 3'…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: or s The diagram above illustrates the process of statement) Row А. B. C. D. i translation…

A: Translation is the process by which RNA is used to make proteins.Transcription is the process of…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: Which of the following is the MRNA coding for the peptide trp-met-gly- ser-his? A.…

A: The genetic codes are the sequence of nucleotide that governs the formation of proteins.

Q: ollowing is the sequence of a segment of mRNA: CGA AAA GUU UUU What are the anticodons of the…

A: mRNA is the polymer of nucleotides formed by the process of transcription using the DNA template…

Q: A peptide is produced in two different cells. The primary structure is the same in both cells, but…

A: Polyadenylation:Increases the stability of the mRNAIt is essential for translational…

Q: Without using your textbook, determine what protein sequence would be translated from the mRNA…

A: DNA is the store house of genetic information. This information is in the form of nucleotide…

Q: Define the following terms: a. noncoding RNA b. miRNA c. siRNA d. snoRNA e. lncRNA

A: RNA is the macromolecule which was present in all biological cells.it is mainly involved in the…

Q: Define the following terms: a. Okazaki fragment b. ter region c. tus protein d. transcription…

A: The terms needs to defined are as follows: a. okazaki fragments b. ter region c. tus protein d.…

Q: Some events that take place in proteins synthesis are shown below: A. An enzyme reads the gene…

A: TRANSCRIPTION It is the process of transfer of sequence information from DNA  to RNA . The DNA…

Q: LIOCTOTmats Provide the three-letter amino acid sequence expected from each of the following mRNA…

A: Question - 1- Provide the three-letter amino acid sequence expected from each of the following mRNA…

Q: I. List the sequences of RNA that would be transcribed from the following DNA template sequences. а.…

A: Transcription is the initial stage in gene expression, when genetic information is utilised to build…

Q: 55 __________________ assemble to form a spliceosome, the splicing machine that excises introns. A.…

A: Introduction Transcription is a process where mRNA is produced from DNA. After transcription mRNA…

Q: A nonsense mutation Select one: a. results in a larger protein being produced from the mutated gene…

A: Introduction :- There are a number of disorders known to be caused by nonsense mutations, including:…

Q: Attached is a region of DNA containing a transcription unit. Match the boxes with the terms…

A: The DNA contained the genetic information that is transcribed into mRNA by the process of…

Q: What potential polypeptides can be produced from the following mRNA sequence? There are more than…

A: In our body genetic information is stored in form of DNA. DNA multiples itself by replication. DNA…

Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…

A: A DNA molecule is a double-helical structure.

Q: Coding strand: Template strand: 5' AAGACCTATATAATGACGAACGATATT 3 3 TTCTGGATATATTACTGCTTGCTATAA 5

A: Transcription is the process that synthesis the mRNA transcript from the double-stranded DNA by the…

Q: These tRNAs line up along an mRNA in this order; what is the protein they will produce? 5'-ACA…

A: The process of synthesising proteins is known as translation. Codons are the trinucleotide bases…

Q: a. promoter region b. RNA polymerase C. antisense strand d. poly-A tail e. 5' cap f. splicing 8.…

A: Introduction :- A promoter is a DNA region where RNA polymerase starts transcription of a gene.…

Q: transcription should be done from the 5' DNA chain. 1. a. 3' DNA: b. 5' DNA: c. mRNA: d. Amino…

A: This exercise involves the process of replication, transcription and translation. In the process of…

Q: Use the Genetic Code below to help you answer the following questions.  The nucleotide sequence of…

A: Mutation is the change in the genetic makeup of the organism, mutation particularly in the genes can…

Q: Part of a gene is written below, and transcription begins at the boxed T/A base pair and proceeds…

A: Gene is present on a chromosome and contains hereditary information. These genes are later…

Q: A gene contains the sequence CGCATACGGTAC that results in the amino acid sequence arg-ile-arg- tyr.…

A: The translation is a process where a mature mRNA sequence is converted into respective amino acids…

Q: Below is the sequence of MRNA. 1. if U is mutated to C, then it will lead to a [ Select ) mutation.…

A: Answer :- 1. UGU (Cys) is converted to UGC (Cys) - silent mutation

Q: The promoter is a stretch of nucleotides found in the Select an answer and submit. For keyboard…

A: DNA is a type of nucleic acid and it is the genetic material in living organisms. It is a double…

Q: Translate the following mRNA transcript   5’CGCCGAUGCGCGAUAUGUGGUAA’3   A. RRCAICG   B. ADARYVV   C.…

A: mRNA, or messenger RNA is a type of RNA (ribonucleic acid) that plays a crucial role in the process…

Q: Identify the anticodon sequences for an mRNA sequence that is 5'-AUG GGC ACU CAU-3'. Select one: a.…

A: An anticodon is a trinucleotide sequence that is complementary to a matching codon in a messenger…

Q: which of these choices represents one possible corresponding mRNA sequence that can be transcribed…

A: One of the initial steps in gene expression is transcription. Only one DNA strand, known as the…

Q: AUGCCGCAAUCUGUUCACGCACUCAUGUG TII CAC & CACICATETE Direction of synthesis- BTTT ATGCCGCA сш TTT…

A: The term "mRNA" is defined as a single-stranded molecule that carries genetic code from DNA used to…

Q: Considering only the listed genetic elements in the figure below, how many different mRNAs and…

A: Ribosomes have the ability to convert every mRNA molecule into polypeptides. Beginning with the…

Q: Below is the CODING sequence of a gene. An A is inserted at position 131. Insert the variant and…

A: Introduction  Central Dogma: it is the key mechanism by which DNA can be transcribed into mRNA by…

Q: Define (whether post-transcriptional, post-translational, transcription) and describe the regulation…

A: Ferritin is a key player in controlling Fe levels in the body. It regulates the amount of Fe it…

Q: What is the corresponding mRNA sequence of the polymer? 3'CAG TTA AGC CTC GGT TAC CAG GAT ACG GGA 5'

A: Translation is a process which takes place on the ribosomes. It is step of protein synthesis where a…

Q: Consider this sequence below:  GAG TAC ACG AGT GGA Which of the following options is an example of…

A: DNA is a self-replicating molecule. The process by which mRNA is produced from DNA is called…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.