If the sequence of an mRNA is GAGUUCACAGUAGGC, the sequence of the template strand of the corresponding gene is... which of the following answers? a. CTCAAGTGTCATCCG b. GCCTACTGTGAACTC c. 3' GAGTTCACAGTAGGC 5' d. GAGTTCACAGTAGGC e. none of the above

Q: Exons 1, 2 and 3 of a human gene are 156, 224 and 524 bp long respectively. The introns 1 and 2 are…

A: Introduction :- Exons are the coding regions of an RNA transcript or the DNA that codes for it that…

Q: Are the following statements TRUE or FALSE?

A: a.It is a false statement. Post transcriptional RNA processing occurs in the nucleus of the cell and…

Q: Consider the following DNA sequence: CATGTGTAGTCTAAA. Address the followin questions: AWrite the…

A: In DNA,the genes are present.From these genes mRNA is formed by transcription. This mRNA undergoes…

Q: Match Column A with Column B. |Intron is removed from the MRNA transcript A 1st event v MRNA is…

A: Transcription is the mechanism by which mRNA is produced from template DNA in molecular biology. As…

Q: a. The promoter is to the right so transcription goes right to left. b. This sequence 5’…

A: Transcription is is a cellular process by which DNA can produce RNA by the use of RNA polymerase…

Q: . Show (on the image) 3 steps that must be taken to produce a mature mRNA molecule from this pre-…

A: The genetic material which is the DNA undergoes the process of replication to produce exact copies…

Q: A geneticist induces a mutation in eukaryote cells. The mutation results in an inability to form the…

A: Mutation results in alteration of a nucleotide sequence of DNA which caused due to the mistake in…

Q: If an MRNA is alternatively spliced, then different introns are removed from a pre-MRNA, producing…

A: Alternative splicing is the process of splicing different combinations of splice sites with a…

Q: Certain introns can self-excise from RNA.   a. false   b. true

A: Rare introns that create a ribozyme self-splice, carrying out the tasks of the spliceosome by RNA…

Q: A promoter is, choose the correct answer... a. the binding site for the ribosome on a messenger RNA…

A: Transcription is a process in which a transcript ( RNA ) is formed. It takes place by the common…

Q: Identify the correct mRNA that will be produced from this NON-TEMPLATE or CODING strand: TAG CCG ATG…

A: The coding strand is the DNA strand whose base sequence is similar to its primary transcript (RNA).…

Q: or s The diagram above illustrates the process of statement) Row А. B. C. D. i translation…

A: Translation is the process by which RNA is used to make proteins.Transcription is the process of…

Q: What mRNA is transcribed from each DNA sequen а. 5'-GTTCTАС-3' 3'- -5' b. 5'-ATTTGAAA-3' 3'- -5' с.…

A: The method of constructing an RNA copy of a genetic sequence is known as transcription. That copy,…

Q: If the sequence of DNA on the template strand of a gene is AAA,the mRNA codon produced by…

A: Transcription is the process of formation of RNA using the DNA template strand. Both strands of a…

Q: A. RNA polymerase binds to a gene’s promoter.   B. RNA polymerase moves over the gene and unzips the…

A: transcription is the process in which m RNA is formed as directed by the template strand of DNA.

Q: A peptide is produced in two different cells. The primary structure is the same in both cells, but…

A: Polyadenylation:Increases the stability of the mRNAIt is essential for translational…

Q: A given section of DNA with the sequence TACACTGGTCAT is transcribed. What is the corresponding…

A: Since we know in RNA Thymine is replaced by Uracil. So Adenine is binded to Uracil. This forms the…

Q: Considering each nucleotide sequence in an mRNA molecule: [1] write the sequence of the DNA template…

A: Gene expression is the process by which the instruction in the DNA is converted to products through…

Q: The following protein sequence was made. N-MET TYR GLN GLN CYS-C a. Using the top most option from…

A: Introduction Amino acids are chemical molecules that combine to produce proteins; hence, they are…

Q: Which of the following are steps of transcription? Select all that apply. a.RNA polymerase…

A: The function of a gene can be studied through expression in a particular cell and its interactions…

Q: Which of the following is not involved in the elongation of prokaryotic peptide? a. EE-Tus, EE-Ts,…

A: The translation is the process by which protein is synthesized with the help of mRNA, tRNA, and…

Q: The following is the DNA sequence of the entire protein-coding region for some small gene in a…

A: The flow of information from DNA to RNA is known as Transcription. (a) Transcription: It is a…

Q: A nonsense mutation Select one: a. results in a larger protein being produced from the mutated gene…

A: Introduction :- There are a number of disorders known to be caused by nonsense mutations, including:…

Q: mRNA is the type of RNA that gets translated. A. True  b. False    Transcription forms new…

A: DNA (deoxyribonucleic acid) is the hereditary unit of an organism. The DNA is passed on from one…

Q: A. rRNA is used to  transfer amino acids to the ribosome. make up the large ribosomal subunit. make…

A: Introduction :- Ribosomal RNA (rRNA), a molecule in cells that is exported to the cytoplasm and is a…

Q: which of the following is not a major factor in regulating specific protein content in the cell? A.…

A: Introduction  Cell regulation refers to the mechanisms and processes that control the behavior of…

Q: You are given the following template strand of DNA: 5'-CGATTGCGATTGGGCATGG-3' A. Transcribe this…

A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides that join together via a 3'-5'…

Q: a. Write the sequence of the MRNA synthesized from the upper strand. b. Indicate the 5'and 3'ends of…

A: Answer : a. Sequence of mRNA synthesized from the upper stand - 5' AUGCCAUUUUGA 3' b. 5' and 3' ends…

Q: Which of the following mutations is most likely to cause a single amino acid difference during the…

A: The translation is the process of translating the sequence of a messenger RNA (mRNA) molecule to a…

Q: You genetically modified a bacterium so it can only produce ribosomes from a plal The most immediate…

A: Protein synthesis takes place on the ribosomes in both prokaryotes and eukaryotes and this process…

Q: A small section of bacterial mRNA has the following nucleotide sequence: GGC UAG GUC UUU The tRNA…

A: The encoding of proteins by the DNA involves two processes: transcription and translation.…

Q: In eukaryotic organisms, pre-mRNA transcripts are formed and need to be modified in order to create…

A: The process of converting a pre-mRNA transcript into a mature mRNA molecule in eukaryotes involves…

Q: If a eukaryotic mRNA has failed to have a cap attached to its 5' end, what would the negative…

A: The process of transfer of information encoded in the DNA to the RNA is called transcription. The…

Q: Which part of a tRNA molecule acts as an amino acid attachment site?   a. the 5' end   b.…

A: tRNA (transfer ribonucleic acid) molecule escorts amino acids to their correct location in a…

Q: If a codon found in the mRNA sequence Tessa CGA, the tRNA anticodon that would bind to that codon…

A: In protein synthesis, the mRNA sequence is read in codons, or sets of three bases. These mRNA codons…

Q: Match the items listed below with "eukaryotic" if they can be found in eukaryotic cells only,…

A: Polyadenylation signal sequence - Eukaryotic Shine Dalgarno sequence - Prokaryotic mRNA - Both tRNA…

Q: Below is the sequence of MRNA. 1. if U is mutated to C, then it will lead to a [ Select ) mutation.…

A: Answer :- 1. UGU (Cys) is converted to UGC (Cys) - silent mutation

Q: (a) Match the following list of RNAS (left side) with their function(s) (right side). w. MRNA X.…

A: The study of molecular biology has led to the discovery of various smaller molecules of RNA which…

Q: Which of the following help(s) to stabilize mRNA by inhibiting degradation?   a. Introns   b.…

A:

Q: Transcription in prokaryotes produces mRNA that is ready to translate, while in eukaryotes the RNA…

A: Transcription is a proces of synthesis of RNA from DNA.During transcription;only one of the strand…

Q: Translate the following mRNA transcript   5’CGCCGAUGCGCGAUAUGUGGUAA’3   A. RRCAICG   B. ADARYVV   C.…

A: mRNA, or messenger RNA is a type of RNA (ribonucleic acid) that plays a crucial role in the process…

Q: Eukaryotic mRNAs a. require processing to produce mature mRNAs b. do not require processing to…

A: Answer of the question given below...

Q: principle function of 5 ons of eukaryotic mRNA IS: a. to ensure that all nucleotides are…

A: Transcription is process in which DNA equence is copied to make RNA. Its the first step of gene…

Q: For a TTT triplet of bases in the template sequence of DNA, the anticodon on the TRNA that binds the…

A: The anticodon is a trinucleotide sequence found on tRNA that controls which amino acid it…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.