Homework Help is Here – Start Your Trial Now!
Science
Biology
I need help finding the correct answers. the formula I used is % idenity=(length of the aligned region- the number of mismatches)/length of the aligned regionx100  for sequnce `1 and 3 I got a 70 percent idenity and 3 mismatches I think I am counting the wrong mismatches ?

I need help finding the correct answers. the formula I used is % idenity=(length of the aligned region- the number of mismatches)/length of the aligned regionx100  for sequnce `1 and 3 I got a 70 percent idenity and 3 mismatches I think I am counting the wrong mismatches ?

Human Anatomy & Physiology (11th Edition)
Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:Elaine N. Marieb, Katja N. Hoehn
Chapter1: The Human Body: An Orientation
Section: Chapter Questions
Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...
See similar textbooks
icon
Related questions
Question

I need help finding the correct answers. the formula I used is % idenity=(length of the aligned region- the number of mismatches)/length of the aligned regionx100 

for sequnce `1 and 3 I got a 70 percent idenity and 3 mismatches I think I am counting the wrong mismatches
? 

can someone correct my answers and show me how they got theres and do not use chegg 

Your task is to test the null hypothesis that the application of fungicide has no effect on the bacterial community structure of the phyllosphere. Based on the data, you will either reject or not reject this hypothesis. Below is a subset of the sequence data provided to you. 1) TGTGTCTTACAGGGGGATAA 2) TGTGTCATATAGCGGGATAA 3) TGTGTCATATAGCGGGATAA 4) TGAGGGATAGAGGGGTATAA 5) TGCGTAATAAAGGGCGATAC 6) TGCGTAATAAAGGGCGATAT 7) TGAGAGATAGAGGGGTATAA 8) TGCGTAATAAAGGGCGATAT 9) TGAGCGATAGAGGGGCATAA 10) TGTGTCTTACAGGGGGATAA 1) These DNA sequences have been aligned already so it is easier for you to spot differences between them. In the table that follows, the a) number of mismatches and b) percentage identity were recorded for every pair of sequences, except for a few. Fill in these blanks (colored grey). sequence # 1 2 3 4 5 6 7 8 9 10 sequence # → 1 85 70 70 70 70 70 70 100 2 3 100 70 aka 70 || | 7| 85| 3 70 0 70 RRRRRS 4 65 70 70 65 95 70 70 95 65 70 70 6 6 6 85 2 5 6 6 70 65 95 6 6 7 7 1 6 6 65 70 70 65 65 70 7 6 6 6 1 7 7 65 90 70 8 6 6 ... 6 17 7 L 1 17 7 aluluk 9 6 6 ala 6 halda 1 +++ 7 2 65 70 70 10 0 7 6 Jalablabalala ++ 3 3 6 6 7 6 6 6 % identity number of mismatches
Transcribed Image Text:Your task is to test the null hypothesis that the application of fungicide has no effect on the bacterial community structure of the phyllosphere. Based on the data, you will either reject or not reject this hypothesis. Below is a subset of the sequence data provided to you. 1) TGTGTCTTACAGGGGGATAA 2) TGTGTCATATAGCGGGATAA 3) TGTGTCATATAGCGGGATAA 4) TGAGGGATAGAGGGGTATAA 5) TGCGTAATAAAGGGCGATAC 6) TGCGTAATAAAGGGCGATAT 7) TGAGAGATAGAGGGGTATAA 8) TGCGTAATAAAGGGCGATAT 9) TGAGCGATAGAGGGGCATAA 10) TGTGTCTTACAGGGGGATAA 1) These DNA sequences have been aligned already so it is easier for you to spot differences between them. In the table that follows, the a) number of mismatches and b) percentage identity were recorded for every pair of sequences, except for a few. Fill in these blanks (colored grey). sequence # 1 2 3 4 5 6 7 8 9 10 sequence # → 1 85 70 70 70 70 70 70 100 2 3 100 70 aka 70 || | 7| 85| 3 70 0 70 RRRRRS 4 65 70 70 65 95 70 70 95 65 70 70 6 6 6 85 2 5 6 6 70 65 95 6 6 7 7 1 6 6 65 70 70 65 65 70 7 6 6 6 1 7 7 65 90 70 8 6 6 ... 6 17 7 L 1 17 7 aluluk 9 6 6 ala 6 halda 1 +++ 7 2 65 70 70 10 0 7 6 Jalablabalala ++ 3 3 6 6 7 6 6 6 % identity number of mismatches
Expert Solution
steps

Step by step

Solved in 3 steps with 4 images

SEE SOLUTIONCheck out a sample Q&A here
Blurred answer
Knowledge Booster
Dissection
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
  • SEE MORE QUESTIONS
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:
9780134580999
Author:
Elaine N. Marieb, Katja N. Hoehn
Publisher:
PEARSON
Biology 2e
Biology 2e
Biology
ISBN:
9781947172517
Author:
Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:
OpenStax
Anatomy & Physiology
Anatomy & Physiology
Biology
ISBN:
9781259398629
Author:
McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:
Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:
9780815344322
Author:
Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:
W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:
9781260159363
Author:
Martin, Terry R., Prentice-craver, Cynthia
Publisher:
McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Inquiry Into Life (16th Edition)
Biology
ISBN:
9781260231700
Author:
Sylvia S. Mader, Michael Windelspecht
Publisher:
McGraw Hill Education
SEE MORE TEXTBOOKS