hich of the following best explains how individuals who inherit phenylketonuria alleles can avoid the symptoms of this disease (mental impairment, foul smelling u It exhibits variable expressivity. The expression of this disease depends on the environment. If the individual removes phenylalanine from their diet they can avoid the disease entirely. PKU alleles are epistatic to alleles of another gene, which acts downstream in phenylalanine metabolism. These individuals supplement their diets with enzymes that break-down phenylalanine.

Q: If a rabbit with the defective gene is not fed plants with the pigment, what color is its fat? Can…

A: As provided with the information that rabbit with active form produce white-colored fat and those…

Q: Coat color of dogs depend upon the action of at least two genes. At one locus a dominant epistatic…

A: There are some important points: We know that genes are functioning independently on each other and…

Q: Mutant C has had the first 5 base pairs deleted (position 1-5). Does this mutation change the…

A: Translation is the process which is responsible for synthesis of protein from the mRNA.

Q: How do dietary factors interact with DNA methyltransferase to affect an organism's phenotype in an…

A: The modulation of gene expression via processes other than the DNA coding sequence is referred to as…

Q: What phenotypes do you think a homozygous tra1hsn animal with a loss of function Egl-1 mutation…

A: The phenotype is the physical appearance or observable trait of an individual genotype. The…

Q: Many aspects of gene function can be nicely explained with the one- gene-one-enzyme hypothesis,…

A: Genes are a set of instructions that determine what the organism is like, its appearance, how it…

Q: If a SNP is found much more frequently in dogs with white fur than in dogs with black fur, the SNP…

A: Single nucleotide polymorphisms (SNPs) in GWAS are essential for understanding the genetic…

Q: CAT: Use your translated amino acid sequences to determine the phenotypes to include in your…

A: DNA is a genetic material which carry information from one generation to next in the form of genetic…

Q: Lactose intolerant individuals do not produce the enzyme lactase. Studies show that the gene that…

A: Lactose sugar is obtained from milk products and milk. When people do not produce enough lactase…

Q: Tay–Sachs disease is a severe autosomal recessive genetic disease that produces deafness, blindness,…

A: Tay-Sachs disease is a neurodegenerative disease that is caused by the mutation of the gene HEXA…

Q: Please answer fast Write two different partial diploid genotypes where Lac Z is produced…

A: The lactose operon is an example of inducible operon in which the expression of downstream genes…

Q: Concentration (%) A researcher is studying environmental conditions that cause the expression of…

A: We analyze the correlation between pH values and active repressor concentration to identify the…

Q: How would you explain gene expression? How is it that a particular genotype is actually expressed as…

A: The central dogma is the flow of information that is carried by a gene that is expressed in the form…

Q: A mutation on an autosome causes a particular protein to be overproduced, and the excess protein…

A: Given that a gene have undergone a mutation in autosomal such that it starts over producing a…

Q: (7) In a family-based alcohol use disorder genetic study, a total of 50 families, each with a pair…

A: We need to gauge hereditary inconsistancy because of heredity by utilizing the equation of…

Q: How many of the mutations listed below would lead to excessive cell growth when the cell was either…

A: Excessive growth occurs when a cell continuously divides and when there is no cell cycle arrest. Myc…

Q: Phenotypes can be controlled by many processes besides the actual genotype present.  Explain one…

A: Epigenetics is the study of heritable phenotype changes that do not involve alterations in the DNA…

Q: 4. The bars in the following sequence indicate the break 5'-CGGGTAТСТАСТААА| TTCGCACTТАCGAGGAТТААСАТ…

A: Introduction : Primers are small, chemically synthesised oligonucleotides that are complementary to…

Q: hemoglobin with different properties. Which of the following contributes to the varying 02 binding…

A: Hemoglobin is an iron containing protwun. The iron portion of the hemoglobin is called the heme and…

Q: he following statements is FALSE [ Select] [Select ] Sickle-cell anemia results in lower oxygen…

A: Sickle Cell anaemia is an autosomal recessive disease in which the hemoglobin is affected and…

Q: ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGG…

A: A mutated sequence can fail to produce a functional protein due to formation of a non-sense codon or…

Q: Beadle and Tatum's experiments led to the "one gene - one enzyme (protein)" hypothesis. In…

A: The genes are the functional part of the DNA that are responsible for the production of RNA by the…

Q: a. For the E.coli haploid genotype below, determine the phenotype for the following proteins. Assume…

A: Lac operon Lac operon or the lactose operon is a gene expression system in E Coli. and many similar…

Q: What phenotypes do you think a homozygous tra1hsn animal with a gain of function mutation in the…

A: Mutation changes genotype frequencies by continually implementing new alleles, that can be…

Q: When the expression of alleles are affected by the presence of other genes,such as sickle cell trait…

A: If a person is a carrier of sickle cell anemia then half of the RBC of the individual are…

Q: In humans, the disease cystic fibrosis is caused by a recessive allele for a gene that encodes a…

A: Given that, in human, cystic fibrosis occurs when recessive allele for a gene (encodes specific type…

Genetic Variation

Genetic variation refers to the variation in the genome sequences between individual organisms of a species. Individual differences or population differences can both be referred to as genetic variations. It is primarily caused by mutation, but other factors such as genetic drift and sexual reproduction also play a major role.

Quantitative Genetics

Quantitative genetics is the part of genetics that deals with the continuous trait, where the expression of various genes influences the phenotypes. Thus genes are expressed together to produce a trait with continuous variability. This is unlike the classical traits or qualitative traits, where each trait is controlled by the expression of a single or very few genes to produce a discontinuous variation.