Genome Assembly with Perfect Coverage and Repeats Given a list of error-free DNA 3-mers taken from the same strand of a circular chromosome. Find all circular strings assembled by complete cycles in the de Bruijn graph B2. Find the circular chromosome sequence. Dataset: ATC ATG CAT CCA GAT GGA TCC TGG
Q: In the space below, draw, color, and label one of the respiratory system models that you examined. I...
A: Respiratory system is concerned with the the taking in of Oxygen and Carbon dioxide outside. It is c...
Q: Plants store extra glucose inside the cell as fiber? A. True B. False
A: INTRODUCTION The plant stores excess glucose in the form of starch.
Q: 1. an organism changing during its life to be better suited for its environment
A: Answer - An organism changing during its life to be better suited for its environment.
Q: Classify each example under the following characteristics of life (1) gathering and using energy, ...
A: Introduction Regardless of complexity, structure, habitat, or other factors, all living things on Ea...
Q: Which of the following graphically shows the evolution of protein sequences? O Blosum-62 BLAST O ide...
A: Protein Sequencing: Protein sequencing is the technique of determining the amino acid sequence of a...
Q: List atleast 50 laboratory equipments or tools. Just list, no need to give the uses
A: ANSWER;- 50 laboratory is;-
Q: the Chronic Myelogenous Leukemia (CML)
A: A disease in which the bone marrow makes too many white blood cells is known as the chronic myelogen...
Q: hén a homozygous plant that produces purple fruit (RR) is crossed with a homozygous plant nat produc...
A: Provided that all of the F1 progenies generate violet eggplant, while neither of the parents do. As ...
Q: How do protozoa reproduce? Give 1 example for each type.
A: Introduction Single-celled organisms are known as protozoa. They range in size and shape from an amo...
Q: Mr. Jones Mrs. Jones Color blind Homozygous for normal vision Color blind Normal vision Carl Dale In...
A: Color blindness is a well-known term that they are usually defined as a hereditary disorder caused b...
Q: Explain characteristics of oomycota? Explain characteristics of mucarales ?
A: Unlike to fund the members of the Phylum oomycota lack chitin in their cell walls and have a life cy...
Q: Insects are attracted to the flower of plants. When they rub against parts of the plant, they carry ...
A: The transfer of pollen grains(carrier of male gamete) from anther to stigma is known as pollination....
Q: В A
A: Answer
Q: what are the factors affecting visual perception of humans?
A: Visual perception is the ability to interpret the surrounding environment through photopic vision (d...
Q: 12. Interpret the following table, where s is the selection coefficient for heterozygote advantage i...
A: Answer: In population genetics, a selection coefficient, usually denoted by the letter s, is a measu...
Q: Lipid-soluble molecules: O are considered polar molecules. O generally diffuse freely through the ce...
A: The correct answer is- generally diffuse freely through the cell membrane.
Q: Question: In a tabular form, compare and contrast cyst from trophozoite stages of the protozoa.
A: Introduction :- Protozoa are single celled organisms. They range in size and shape from an amoeba, w...
Q: Discuss the different structures of protein. What are the five factors that promote protein folding ...
A:
Q: Explain in detail Structure , reproduction and life cycle of mucor .
A: Structure:- Mucor's vegetative structure:- Multicellular fungi, such as Mucor, are organized into ...
Q: Fruit flies (Drosophila) were mated. Cross #1 - 2 male red eyes (se+), wild wings(ap+) X 4 female r...
A: The Dihybrid cross is a crossing between two organisms, being heterozygous to two different traits. ...
Q: Drag and drop the appropriate labels onto the cross section of the Cut Bank below the Highlevel/LRT ...
A: 6)River deposits. 5) vegetated berm 1)top soil(with brick)
Q: Explain the role of isotype exclusion in pro-B cells.
A: Introduction:- In a given lymphocyte, either κ or λ light (L) chain, but not both, can combine with ...
Q: Peas heterozygous for three independently assorting genes were intercrossed. (a) What proportion of ...
A: The phrases homozygous and heterozygous are used to characterise allele pairings. Homozygous people ...
Q: A cross between fruit files with genotypes Aa Bb × aa bb produces the following progeny: 10 Aa Bb 4...
A: Linkage is a phenomenon in which how genes are placed in close proximity to each other but in the sa...
Q: Problem: What is the primary cause of the endangerment of Varanus mabitang (Panay Monitor Lizard)? ...
A: The Panay monitor (Varanus mabitang) is an endangered Monitor lizard. The monitor lizard are harmful...
Q: Denaturation results in the deactivation of the enzyme? A. True B. False
A: Ans)Enzyme structures unfold (denature) when heated or exposed to chemical denaturants and this disr...
Q: n rats, black fur color is dominant to white fur color, and pointy ears are dominant to round ears. ...
A: Introduction: Law of independent assortment is based on dihybrid cross. It states that inheritance ...
Q: An individual who swam in freshwater during the summer after a time experiences intense head pain, n...
A:
Q: Ureter are Tubes that carry urine from the kidneys to the bladder. Bladder is an organ holds the uri...
A: 1) Ureter : It is the tubular structure that extends from the kidney through the hilum (opening of ...
Q: Amine acds primary structure secondary structure hydrogen bond beta-pleated sheets alpha helix fibro...
A: Protein: Proteins are necessary nutrients for human health. They are a component of body tissue and ...
Q: 1999 Question #2 Communication occurs among the cells in a multicellular organism. Choose three of t...
A: Introduction A cell's ability to receive, process, and transmit messages with its surroundings and w...
Q: If you crossed a heterozygous fruit fly with straight wings and red eyes to one with curly wings/whi...
A: A phenotypic ratio helps to determine the likelihood of a trait and is most easily determined by uti...
Q: Which of the following events best explains the annual saw tooth pattern that is seen in the Keeling...
A: Introduction The Keeling Curve is a graph depicting the accumulation of carbon dioxide in the Earth'...
Q: 13. A peripheral membrane protein is best described as a protein a. embedded within the phospholipid...
A: INTRODUCTION Answers of question 13-15 is given below.
Q: The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1)...
A: Central Dogma: It is the complete procedure of replication, transcription, and translation of DNA. T...
Q: Listed below are five amino acids. Use the genetic code to determine the exact codon for each amino ...
A: Note: As Per Guidelines, We Can Answer One Question At A Time. Ask Again To get rest answers. Intro...
Q: Assess the validity of the following statements. Choose TRUE if the statement is correct, if otherwi...
A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: Ost...
Q: 1. Identify the organ.
A: This organ starts from cricoid cartilage and finishes near the heart, where it splits into two parts...
Q: What is one statement that would support the theory that all organisms are related? A) The genetic...
A: In addition to being degenerate, the genetic code is also called to as 'unambiguous,' implying so ea...
Q: For goldfish, solid orange coloring is dominant while orange with black spots is recessive. A total...
A: Recessive genotype frequency = q2 = 225/2500=0 .09 Recessive allele frequency=q= Sqrt of q2 =0.3 ...
Q: Which of the following best describes an emergent property? Group of answer choices a property that...
A: The organ system is a very complex creature made up of several systems. Each system in the body has ...
Q: Bacillus cereus and Bacillus thuringiensis are very closely related species and cannot be distinguis...
A:
Q: How do protozoa reproduce? Give 1 example for each type.
A: Introduction Protozoa are eukaryotic single-celled creatures that belong to the kingdom Protista.
Q: Vitamins does not contribute any energy at all to our body? True Or false
A: Every living organisms need energy for doing all of it's cellular activities. This energy is usually...
Q: 1. IDENTIFY THE EPITHELIUM. 2. IDENTIFY THE SPECIAL STRUCTURE PRESENT. 3. IDENTIFY THE POINTED STRUC...
A: Epithelial tissue Epithelial tissue form covering of the external and internal organs of the body.
Q: 1. What does NADPH do? In the Krebs cycle, isocitrate releases a molecule of carbon dioxide, leaving...
A: Introduction Photosynthesis is the process through which plants produce oxygen and energy in the for...
Q: Chapter 11 Antimicrobial Drugs 435 438 Chapter 11 Antimicrobial Drugs ve 2. Which antibiotic work fo...
A: Vancomycon works for Staphylococcus. Vancomycin , a glycopeptide antibiotic that inhibits cell wall ...
Q: Many biology news stories refer to advances in genetics. How are the terms "genetic" and "genetic in...
A: Given: Many biology news stories refer to advances in genetics. Genetics is a branch of biology tha...
Q: What is the role of a virus in gene therapy? O t carries the faulty DNA out of the patient's cells. ...
A: Given: Much attention has, been focussed on the so called genetic metabolic diseases in which a defe...
Q: ) Amino acid sequence of a heptapeptide gave the following information Asp, leu, lys, ,met, phe and ...
A: Introduction Amino acids are the building blocks of proteins. The building blocks of life are amino ...
Genome Assembly with Perfect Coverage and Repeats Given a list of error-free DNA 3-mers taken from the same strand of a circular chromosome. Find all circular strings assembled by complete cycles in the de Bruijn graph B2.
Find the circular chromosome sequence.
Dataset: ATC ATG CAT CCA GAT GGA TCC TGG
![](/static/compass_v2/shared-icons/check-mark.png)
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- DNA Replication Drawing Name: Using penci, you will draw a representation of DNA replication along the leading and lagging strands. Follow the directions below, drawing each element in its proper location along the replicating DNA strand. Once you are sure everything is in the correct place, complete your drawing by adding color to distinguish objects as separate. 1. On the diagram below, label the 5 and 3' onds of both parental DNA strands (you can make up which is which) 2 Label the replication fork 3. Draw and label helicase 4. Label the overall direction of DNA replication 5. Draw and label single stranded binding proteins 6. Draw and label the leadng strand 7. Draw and label a single DNA polymerase IIl on the leading strand 8. Draw and label an RNA primer on the leading strand 9. Draw and label a DNA polymerase I on the leading strand 10. On the lagging strand, draw and label at least three Okazaki fragments 11. On the lagging strand. draw and label at least two DNA polymerase IIl…Matching Type Choose the directionality of the given process. (4 points) What is the directionality of the given process? * 4 points 3'-5' 5'-3' Exonuclease activity Complementary strand of the continuous strand Addition of nucleotides going to the replication fork Addition of nucleotides away from the replication forkGive only typing answer with explanation and conclusion Your analysis has identified that this new organism has same chromosomal structure as that of eukaryotes on earth. However, the average length of linker DNA of the new organism is 100 bp. If the haploid genome of the new organism has a size 6 billion bp, how many nucleosomes will be in this new organism?
- THE MOLECULAR GENETICS OF SICKLE CELL ANEMIA The following is the base sequence of DNA that codes for first eight amino acids of the B chain of hemoglobin. The B chain of hemoglobin contains a total of 147 amino acids so this is a small part of the entire gene. DNA Template Strand: TACCACGTGGACTGAGGACTCCTC 1. What is the minimum number of DNA nucleotides in this whole gene? 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 3. What mRNA will be formed from the template strand of DNA? 4. What amino acids will this mRNA code for? 5. If the 20th base in the template strand of the DNA is changed from T to A, rewrite the new template strand below. 6. When the template strand of the DNA is changed, this is referred to as a mutation. What kind of mutation is this? 8. 7. What mRNA will be formed from the mutated template strand of DNA? What amino acids will this new mRNA from the mutated template strand code for? 9. Are these new amino acids the…Suppose DNA polymerase synthesizes DNA at a rate of 1130 bases per minute in a newly discovered bacteria and that bacteria replicates their chromosome every 40 min. 3' Sugar-phosphate backbone Calculate the total number of nucleotides in the bacterial chromosome. number of nucleotides: F0.34 nm A T Calculate the length of the entire bacterial chromosome using the appropriate information from the diagram of DNA. - 3.4 nm length: nm 3' 2 nmTHE MOLECULAR GENETICS OF SICKLE CELL ANEMIA The following is the base sequence of DNA that codes for first eight amino acids of the ß chain of hemoglobin. The ß chain of hemoglobin contains a total of 147 amino acids so this is a small part of the entire gene. mone formed DNA Template Strand: 3'CACGTGGACTGAGGACTCCTC5' 1. What is the minimum number of DNA nucleotides in this whole gene? 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 4. What amino acids will this mRNA code for? 3. What mRNA will be formed from the template strand of DNA? 5. If the 17th base in the template strand of the DNA is changed from T to A, rewrite the new template strand below. 6. When the template strand of the DNA is changed, this is referred to as a mutation. What kind of mutation is this? 67
- Give only typing answer with explanation and conclusion Recombinant human insulin produced by bacteria carrying a cloned insulin gene, is now the major form of insulin used to treat diabetes. The human insulin gene encodes an mRNA only 333 nucleotides long, but the entire gene spans more than 4000 nucleotides. There are three exons and two introns 1. Every cell in the human body has the same DNA, so very cell has an insulin gene. However in order to use the technique, you described in b, you would have to start with cells from the pancreas the only body cells that actually produce the insulin protein. Why are these the only cells that would work.Do not copy, answer fast and give type answer only Thanks a lot Which of the following is wrong for the description of protein synthesis(A) The large ribosomal subunit is constructed by proteins and ribosomal RNAs. (B) tRNA is necessary for protein synthesis.(C) DNA components are required.(D) GTP is required for the process. Alleles segregate independently of other alleles because:(A) Maternal and paternal chromosomes line up on the either side of the equator during metaphase I.(B) Crossing over in prophase I.(C) Separation of homologous chromosomes in anaphase I.(D) A and B(E) A and C Which statement is wrong for the transcription factors?(A)They can bind to the region out of the promoter.(B)They have two domains, one that binds DNA and the other that activates transcription. (C)Their functions are limited for transcription.(D)They can bind to activators. which statement about biotech is wrong? (A)DNA microarray assay can detect gene expression (B)RT-PCR cannot detect gene…These are written as either accurate or contain errors. Rewrite each one with an error as an accurate statement. Please have an explanation. Thank you! Over time telomeres shorten over time because when the primer is removed at the end of chromosome strand cannot be filled in because there is not free 3’ OH. Semiconservative DNA replication indicates that daughter strands are hybrid molecules with half (one strand being parental) and the other being newly synthesized. A mutation in the gene responsible for transcribing primase would affect only the lagging strand of DNA. In eukaryotes RNA polymerase binds to the activator, specifically at the TATA box to align with the translational start site. Transcription Factors can have more than one function domain. One is the DNA-binding domain and the other is a trans-activation domain. Additive alleles function at one gene to contribute to the phenotype of an organisms, while non-additive alleles at that one gene do not add to the phenotype.…
- Kree DNA has histone like proteins that wrap up in nucleosomes. The Kree have a core DNA length of 255 bp and a linker DNA of 45 bp. The Kree genome is made up of approximately 6x108 base pairs of DNA. Determine the number of nucleosomes in each nucleus.DNA Replication For the following piece of DNA, draw the replicated piece of DNA show me where the original and replicated strands of DNA end up. A ATCCGTTACCCA A ACGATATC C GTTA AC C GC G ITAG GCA ATGG GTTTG CTATAG GCA ATTGG C G CEach metaphase chromatid is about 700 nm in diameter. How many times wider is that than a DNA double helix? Show your work.
![Biochemistry](https://www.bartleby.com/isbn_cover_images/9781305577206/9781305577206_smallCoverImage.gif)
![Biology Today and Tomorrow without Physiology (Mi…](https://www.bartleby.com/isbn_cover_images/9781305117396/9781305117396_smallCoverImage.gif)
![Biochemistry](https://www.bartleby.com/isbn_cover_images/9781305577206/9781305577206_smallCoverImage.gif)
![Biology Today and Tomorrow without Physiology (Mi…](https://www.bartleby.com/isbn_cover_images/9781305117396/9781305117396_smallCoverImage.gif)