Genetic Variation
Genetic variation refers to the variation in the genome sequences between individual organisms of a species. Individual differences or population differences can both be referred to as genetic variations. It is primarily caused by mutation, but other factors such as genetic drift and sexual reproduction also play a major role.
Quantitative Genetics
Quantitative genetics is the part of genetics that deals with the continuous trait, where the expression of various genes influences the phenotypes. Thus genes are expressed together to produce a trait with continuous variability. This is unlike the classical traits or qualitative traits, where each trait is controlled by the expression of a single or very few genes to produce a discontinuous variation.
- A allele
- G allele
- both
-neither
![QUESTION 9
The second coding exon of the cystic fibrosis transmembrane conductance gene is
5' TGGACCAGACCAATTTTGAGGAAAGGATACAGACAGCGCCTGGAATTGT 3
on the sense strand. The underlined position marks a SNP locus. The other allele at this position is "G". The gene is found on chromosome 7.
The following is ASO analysis done with a probe for the G allele and the A allele.lf the woman has Cystic fibrosis, which of the 2 alleles is the disease
allele?
Woman
Man
Child
ASO-OligoA
ASO-OligoG](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2Fe413ba53-b36f-40cd-9f3b-7507865f79d2%2F3fb952a5-9cc3-4d3f-8313-aae78f807d87%2Fzkbishp_processed.jpeg&w=3840&q=75)
![](/static/compass_v2/shared-icons/check-mark.png)
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
![Human Anatomy & Physiology (11th Edition)](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
![Biology 2e](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
![Anatomy & Physiology](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
![Human Anatomy & Physiology (11th Edition)](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
![Biology 2e](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
![Anatomy & Physiology](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
![Molecular Biology of the Cell (Sixth Edition)](https://www.bartleby.com/isbn_cover_images/9780815344322/9780815344322_smallCoverImage.gif)
![Laboratory Manual For Human Anatomy & Physiology](https://www.bartleby.com/isbn_cover_images/9781260159363/9781260159363_smallCoverImage.gif)
![Inquiry Into Life (16th Edition)](https://www.bartleby.com/isbn_cover_images/9781260231700/9781260231700_smallCoverImage.gif)