Question10All of the following are characteristics of Transfer RNA except:O a. Only one loop has the codon that is complementary to the anticodon sequence on mRNANot yetansweredO b. Amino acids are attached at the 3' endMarked out ofO c. Each tRNA is used repeatedly during the translation process1.00P FlagO d. It's a single strand made of 80 nucleotides, has four regions of base-pairing, and 3 loopsquestionОе.Anticodon of some tRNAs recognize more than one codon by the wobble base pairing

Name: Question10All of the following are characteristics of Transfer RNA ex
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Question10All of the following are characteristics of Transfer RNA except:O a. Only one loop has the codon that is complementary to the anticodon sequence on mRNANot yetansweredO b. Amino acids are attached at the 3' endMarked out ofO c. Each tRNA i

Science

Biology

föllowing are characteristics of Transfer RNA except: O a. Only one loop has the codon that is complementary to the anticodon sequence on MRNA O b. Amino acids are attached at the 3' end Each TRNA is used repeatedly during the translation process O c. O d. It's a single strand made of 80 nucleotides, has four regions of base-pairing, and 3 loops O e. Anticodon of some tRNAs recognize more than one codon by the wobble base pairing

föllowing are characteristics of Transfer RNA except: O a. Only one loop has the codon that is complementary to the anticodon sequence on MRNA O b. Amino acids are attached at the 3' end Each TRNA is used repeatedly during the translation process O c. O d. It's a single strand made of 80 nucleotides, has four regions of base-pairing, and 3 loops O e. Anticodon of some tRNAs recognize more than one codon by the wobble base pairing

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 3TYK

See similar textbooks

Similar questions

From the mRNA base sequence CUU-AUG-GCU-UGG-CCC-UAA A.What anticodon sequences of tRNA’s are coded? B.What was the base sequence in the original DNA strand was made? Please answer completely will give rating surely Both questions answers needed
50 Which of the following molecular structures contan codons? A a protein B mRNA CIRNA DIRNA EB and C
The sequence below is a template strand sequence for a gene (a very short one!). Identify the start codon and the amino acid sequence of this gene. Write your answer in 3 letter amino acid code. Put a hyphen between each amino acid. You should also include a description of any working or steps you have taken to determine your answer. 5' AGTCAGCAAGAAGACATCAGTGTTCCCATCTGT 3' Paragraph V B I U A = 8⁰ + v 11.
50 Which of the fokong stages of translation require Energy A Formation of aminoacyl-IRNA B. Elongation Termination D Formation of translation initiation complex E. All of the options are correct
TAAA box کر کر کے Translation initiation codon Exon 1 Intron 1 D. No effect E. Protein truncation Exon 2 Intron 2 Stop codon Exon 3 Mutation site, deletion of 2 nucleotides Polyadenylation signal 173. The diagram shows the structure of a hypothetical gene. Which of the following is most likely to result from the mutation at the site indicated? A. 5' Capping defect B. Abnormal translation initiation C. Altered transcription
Effect of DNA Mutations on Protein Structure & Function The structure of a typical human protein coding MRNA including the untranslated regions (UTRS) Cap 5' UTR Coding sequence (CDS) Poly-A tail 3' UTR Start Stop 5' 3' Question 2: Which of the following mutations may affect translation initiation? A. Silent mutation in the coding sequence. B. Missense mutation in the coding sequence C. Deletion of four bases in the 5'-UTR D. Deletion of four bases in the 3'-UTR
Question 3 of 10 Question 3. Why must RNA splicing be absolutely precise? A. A single base error at a splice junction will cause a large deletion. B. A single base error at a splice junction will cause a large addition. C. A single base error at a splice junction will change the reading frame and result in mRNA mistranslation. D. A single base error at a splice junction will cause a large inversion.
Row A B. C D Process 1 transcription transcription translation Protein Synthesis in an Animal Cell Select the row below that correctly identifies the name of Process 1 as well as a sequence that could represent Structure 1. Sequence of Structure 1 CGA ATT GTA CAA CGA AUU GUA CAA CGA ATT GTA CAA CGA AUU GUA CAA translation Structure 1 Process 1 Structure 2 ORA Process 2
During translation initiation, when does the 30S ribosomal subunit bind to the 50S ribosomal subunit? O When it binds the Shine-Dalgarno sequence. O When charged initiator tRNA-fMet is present in the P site. J O After the first peptide bond is formed O It is always bound to the 50S subunit O When release factor falls off 7
put in correct order the steps for initiating translation. 1. Binding of initiator tRNA to mRNA 2. Binding of large ribosomal subunit to mRNA 3. Binding of small ribosomal subunit to mRNA 4. Binding of tRNA with 2nd amino acid to the A site 5. Formation of covalent bond between methionine and second amino acid A) 1, 2, 3, 4, 5 B) 3, 1, 2, 4, 5 C) 1, 3, 2, 4, 5 D) 2, 3, 1, 4, 5 E) 3, 2, 1, 4, 5
First Letter A G U с 22. Using the provided "Genetic Code-Reference" answer the following question. Based on the following DNA template strand, write out the amino acid chain produced. 23. Consider the following mRNA base codon sequence 5'-AUC-GAA-3' and the provided "Genetic Code-Reference". Genetic Code-Reference UUU UUC UUA UUG CUU CUC CUA CUG (mutated or silent) (mutated or silent) b. Briefly explain your reasoning for each. (be sure to include both parts) AULLY AUU a. Label which of the following would result in a mutated amino acid sequence or a silent mutation. (May help to first determine the original amino acid sequence, then compare to mutations) U Phe mRNA codon sequence: anticodon sequence: amino acid sequence: Leu Leu 5'-AUA-GAA-3' Val 5'- AUC-GAC-3' AUC Ille AUA AUAJ *AUG Met/Start GUU GUC GUA GUG UCU UCC UCA UCG) CCU) CCC ccc CCA 000 CCG ACU ACU ACC ACA ACG, C GCU GCC GCA GCG Second Letter Ser Pro Thr 3'-CAA-GTC-TGT-5' Ala UAU UAC) Tyr Туг A **UAA Stop UAG Stop CAU] CACJ…
29. Translation ends when a release factor causes the translation complex to dissociate TRNA recognizes a codon on mRNA O the polypeptide chain is complete the terminator sequence on the gene is encountered O the large ribosomal subunitsplits from the small subunit