Which of the following codons in an MRNA can be recognized by the tRNA with UAA anticodon sequence (5-UAA-3)7 OA LRAG ARG-3) OLUUC IS UC-3) non sionn AUU S AUU 3
Q: Small ribosomal sub-unit MRNA Codon Large Ribosomal sub-unit Amino acid Anticodon A C. D. F Three…
A: Nucleus is main controller of the cell which carries genetic material . It also contain thread like…
Q: How many different mRNA sequences can encode a polypeptide chain with the amino acid sequence…
A: Polypeptide chain includes a sequence of amino acids that are coded by different codons during the…
Q: What amino acid is coded for by each codon? a. GCC b. AAU c. CUA d. AGC e. CAA f. AAA
A: GCC -Alanine AAU - Asparagine CUA - Leucine AGC- Serine CAA - Glutamine AAA - Lysine
Q: TRACE THE CODE| Order of bases in MRNA (codon) AUC Order of bases in ERNA (anticodon) Order of bases…
A: Complete this table of codes.
Q: If the DNA sequence is ATG-CGT, the mRNA codons are ___. ATG-CGT UAC-GCA GUA-CGU AUG-CGU…
A: DNA full form is deoxyribonucleic acid. DNA is the main constituent of the chromosome. It contains…
Q: Shown below is a codon in an mRNA. What is the correct sequence of the tRNA anticodon that…
A: The given messenger ribonucleic acid (mRNA) codon 5’-CAG-3’ codes for the amino acid glutamine.…
Q: 70. Which of the following codes for the stop codon in mRNA? A.UUC B.UGA C.AUG D.AAA
A: Answer B) UGA
Q: Isoleucine is encoded by three codons (5')AUU, (5')AUC, and (5')AUA. These three codons are…
A: Wobble hypothesis: This hypothesis was given by Francis Crick. According to this hypothesis the…
Q: A certain mRNA strand has the following nucleotide sequence: 5'—AUG—ACG—UAU—AAC—UUU—3' What is the…
A: DNA is the double-stranded molecule that is the genetic material in most animals except for some…
Q: The following sequence represents triplets on DNA: TAC CAG ATA CAC TCC CCT GCG ACT Give the mRNA…
A: Answer: CENTRAL DOGMA : It is the complete process of replication of DNA , transcription of DNA and…
Q: Codons are found on __________ and they contain __________ bases. a. tRNA, 4 b. mRNA, 3 c. tRNA, 3…
A: Codons are found on mRNA and they contain 3 bases. The genetic code is the stored genetic…
Q: When a ribosome reads a codon onmRNA, it must bind to the ____________of acorresponding tRNA.a.…
A: Protein synthesis involves two processes known as transcription and translation. In transcription,…
Q: A portion of a strand of a much longer molecule has a nucleotide sequence of AGCAGGCAGATC. During…
A: Translation, in molecular biology and genetics, is the mechanism by which ribosomes in the cytoplasm…
Q: list the amino acid sequence that would be made in a ribosome using these codons: AUG CUA AGU…
A: A ribosome consists of two basic pieces of units containing a large and a small subunit. During the…
Q: What is the anti-codon in tRNA that corresponds to the codon pGpCpA in MRNA? А. рТрGpC В. рСpGpT С.…
A: During replication and transcription a nucleic acid was copied from another nucleic acid. Hence this…
Q: Which of the following codons is called the start codon?
A: AUG is the Start codon, which codes for Methionine.
Q: Which of the following MRNA sequences codes for the polypeptide sequence tyrosine-leucine-alanine?…
A: The mRNA is a single-stranded molecule of RNA that corresponds to the genetic sequence of a gene.…
Q: Consider the wobble rules listed in Table 15.2. An MRNA has the stop codon 5' UAA 3'. What TRNA…
A: Codon is a triplet of nucleotide base pairs.
Q: An MRNA has the codon 5' GUA 3'. What tRNA anticodon will bind to it ? A) 5' CTA 31 B) 5' ATC 3' C)…
A: DNA replication is the process of formation of identical copies of DNA. It occurs in the nucleus of…
Q: Which of the following is located at the C-terminus of a newly synthesized eukaryotic proteins?…
A: Initiation of translation occurs when the small ribosomal subunit binds with initiation factors and…
Q: Which of the following nucleotide triplets best represents a codon?
A: Introduction:- A codon is a triplet of bases (or nucleotides) in the DNA coding for one amino acid.…
Q: The anticodon loop of one of the t RNA Gly molecules from Escherichia coli is as follows: C--G G--C…
A: tRNA is a specialised RNA molecule that transports the amino acids during translation. A tRNA is…
Q: 1. A tRNA has the anticodon sequence: 5'-IGC- 3'. which codon will not decipher with this tRNA? a)…
A:
Q: During initiation of translation, a is positioned first at the…
A: The translation is the process of synthesis of proteins that occurs on the ribosomes in the…
Q: If the MRNA sequence is 5' - START(AUG) - UUU - AAA - AGU - GGU - 3', then what is the corresponding…
A: Transcribing tRNA from mRNA, mRNA tRNA U A G C A U C C The above table can be used for…
Q: Which of the following is the anti-codon present on the t-RNA that carries fMet to the start codon?…
A: a. The start codon is the first codon of a messenger RNA transcript that is translated by a…
Q: The following segment of DNA codes a protein. The uppercase letters represent exons, the lowercase…
A: Introduction Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum…
Q: The tollowing mRNA transcript would result in which polypeptide sequence? 5'-ACU UUC ACU AUG UUU UUA…
A: Protein consists of amino acids linked by amide bonds or peptide bonds.
Q: Assume that the nucleotide at the 5′ end of the first tRNA’s anticodon (the tRNA on the left) in…
A: The 61 codons codes code for 20 different amino acids. So, there must be 61 different tRNA…
Q: Which of the following codons is called the start codon? a.UAA b.UGA c.UAG d.AUG
A: The connection between the series of nucleotide on mRNA and series of amino acid in the polypeptide…
Q: In bacterial mRNA, the initiating AUG codon is preceded several nucleotides away by a purine-rich…
A: Translation is the process by which a polypeptide is formed using an mRNA as its template.…
Q: AAG ATA CAG GCT CGG TAA For the DNA sequence shown above, identify the following: a. mRNA codons…
A: Introduction When DNA makes the same copy of itself then it is called replication. Each replicated…
Q: The following sequence represents triplets on DNA:TAC CAG ATA CAC TCC CCT GCG ACT a. Give the mRNA…
A: Hello, thank you for your question. The second part of the question seems to be incomplete,…
Q: If the codon for Histidine is 5' CAU 3' in an MRNA molecule, the anticodon on the TRNA is: UAC ATG…
A: In every group of messenger ribonucleic acid (mRNA), there are three bases. A codon is also there…
Q: A series of tRNAs have the following anticodons. give all possible codons with which each tRNA can…
A: Anticodon relatable term with another term which is codon. A codon is a three-nucleotide stretch of…
Q: is the term used to describe the genetic coce because the rules net relate the nucleotide sequence…
A: Ans 1:- Universal is the term used to describe genetic code being same for most organisms.
Q: The first nucleotide in mRNA that will be synthesized from DNA below is: 3'-…
A: During the transcription process RNA is produced from the DNA within the nucleus of eukaryotic cells…
Q: The following diagram illustrates a step in the process of translation. Identify the following…
A: The diagram illustrates the process of elongation of polypeptide chain by adding amino acids one by…
Q: A single base substitution mutation is likely to have a less harmful effect when the base change…
A: A single base substitution mutation is also known as the point mutation which changes a single base…
Q: A particular triplet of bases in the template strand of DNA is 5' AGT 3'. The corresponding codon…
A: ANSWER;- 3'UCA 5' Explain;- Transcription is a process of a particular DNA sequence being copied…
Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…
A: DNA consists of two intertwined polynucleotide strands: coding strand and template strand. The…
Q: What is the tRNA triplets codon that would fit the mRNA- 5' AUG AUC UAU GGG CCA AUU GCA UGA 3'
A: The three triplets which are complementary to the mRNA sequence forms the anticodon in transfer RNA.…
Q: during translation, each codon on the mRNA complementary base pairs with an snticodon on.....
A: Translation is the process in which proteins are synthesized by ribosomes.Translation occurs after…
Q: Which of the following changes to a DNA sequence would cause a frameshift mutation? OA. The…
A: Mutation are the changes that arise due to abrupt change in sequence of base pairs. It may be a…
Q: 8. Codons are sequences that correspond to specific amino acids or signals during protein…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: An amino acid sequence reads:N—Met-Gln-Leu-Arg-Cys—C Write out one possible mRNA sequences with a…
A: The process by which mRNA is translated to the amino acid sequence is termed as translation. It…
Q: Which of the following would not be found in a mature mRNA in a eukaryotic cell? A Star Codon B…
A: Select the component that is not present in mature mRNA of eukaryotic cells. The given options areA.…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:Figure 28.41 gives some examples of recombination in IgG codons 95 and 96, as specified by the Vkand Jkgenes. List the codon possibilities and the amino acids encoded if recombination occurred in codon 97. Which of these possibilities is less desirable?Using the Genetic Code Table in Figure 1.3, what is the proper sequence of amino acids in the polypeptide chain based from the given codons of MRNA (3' AAU GCC AGU GGU 5')? * U UUU Phe UCU) UC UCA UCG UAU] UAC Tyr UAA Stop UGA Stop A UAG Stop UGG Trp G UGU U UUC) UGC Cys Ser UUA Leu UUGJ CU) CCU CAU1 CGU His CUC CAC CAA CGC CC Leu CCA Pro Arg CUA CGA A Gin CUG) CG CAG CGG G AUU) ACU) AGU AAU1 Asn AAC, Thr AAA1 U AGC }Ser č A G AUC lle ACC A AUA J ACA AGA AUG Met ACG, AAG}Lys AGG Arg GGU GUU) GUC Val GCU) GCC GCA GCG J GAU1 Asp GACI Ala GGC GGA GGG ) G GUA Gly GAA1 GAG) A Glu GUG) G Figure 1.3 Alanine, Serine, Glycine, Asparagine Serine, Glycine, Asparagine, Alanine Glycine, Asparagine, Alanine, Serine Asparagine, Alanine, Serine, Glycine
- Which of the lettered arrows in the diagram of translation indicates an amino acid? A/G|G A AUGGG A CIf DNA segments changes from GCATAG to GCATA, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base U A G 0001 Phenylalanine UCU UAU1 Tyrosine (Tyr) UAC UGUT FCcysteine (Cys) UGCJ U UUCJ (Phe) UCC Serine (Ser) UCA U UUA1 UAAT UGA - Stop A FLeucine (Leu) UUG- FStop UAG- UCG- UGG - Tryptophan (Trp) G CU- CCU CGUT CAU1 Histidine (His) CAC U CUC FLeucine (Leu) CUA CC Proline (Pro) CCA CGC FArginine (Arg) CGA CAA1 Glutamine A CAGI (Glu) CGG- CUG- CCG- G AUU AAU1 Asparagine ACU1 AGUT FSerine (Ser) AGC- AUC FIsoleucine (le) ACC Threonir AACJ (Asn) A AUA- ACA (Thr) AAA1 FLysine (Lys) AAG- AGA, FArginine (Arg) AGG- A Start Methionine (Met) ACG- AUG - GUU- GCU GAU- GGU | Aspartic Acid GAÇJ(Asp) U GỤC Valine (Val) GUA GCC FAlanine (Ala) GGC Glycine (Gly) GGA G GAA1 Glutamic Acid A GCA GCG- GAGJ (Glu) GGG- GUG- GWhich of the triplets below is a possible anticodon for a tRNA that transports Leucine (Leu) to a ribosome? Second letter C UGU cys UCU1 UCC UCA UCG UAU Tyr UACS Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUU UGCS Phe UUC U UUA UUG FLeu CAU HiS CGU] CUU CUC Leu CCU ССС CCA CCGJ CACS CGC Arg CGA CAA GIn Pro C CUA CUG J CAG S CGG AUU AUC lle AUA AAU Asn AGU ser ACU АСС Thr ACA AAC AAA ys AGA Arg AAG J AGC AUG Met ACG Lys AGG J GUU GUC CUA Val GAU ASP GCU GACJ GCC FAla GGU] GGC CGA Gly CCA C CAA M UCAG Third letter UCAG UCAG First letter
- The following segment of DNA codes a protein. The uppercase letters represent Exons, the lowercase letters introns. Draw the pre- mRNA, the mature mRNA and translate the codons using the genetic code to form the protein. Identify the 5’UTR and 3UTR 5’- AGGAAATGAAATGCCAgaattgccggatgacGGTCAGCaatcgaGCACATTTGTGATTTACCGT-3’The DNA in the coding strand below contains a short imaginary sequence for a short protein in Squibillus notables (imaginary bacterial organism). Indicate the mRNA and amino acid sequences. Label the 5' and 3' ends, the amino (N-terminus) and carboxyl (C-terminus) ends and start/stop codons, if present, as appropriate. 5'- ATGTACCTCGACGATCAAGGCAA -3'Write the sequence of the mRNA molecule synthesized from a DNA template strand having the sequence 5'-ATTACAGGCGGT-3' 5'- UAAUGUCCGCCA Incorrect Write the amino acid sequence encoded by the mRNA base sequence 5'-GAGUUAGUUUGUAAGUGC-3' Assume the reading frame starts at the 5' end. Refer to the codon table . Amino acid sequence: Glu-Leu-Val-Cys-Lys-Cys What is the sequence of the polypeptide formed on addition of poly(UUAC) to a cell-free protein-synthesizing system that does not require a start codon? Enter an amino acid sequence of four amino acids using the three-letter abbreviations. Polypeptide sequence: Poly( -3' Glu-Leu-Val-Cys-Lys-Cys
- An mRNA transcript has the following complete sequence: 5'-AUGCCUACGUUACGGACC-3' Rewrite the sequence to give it a missense mutation. Circle/highlight the mutation. Explain how your specific mutation would affect the formation and structure of the 2nd (middle) Base of a Codon 1st U CA G 3rd Base Base UUU Phe UUC Phe UUA Leu UUG Leu UCU Phe UCC Phe UCA Leu UCG Leu UAU Tyr UAC Tyr UAA STOP UAG STOP UGU Cys UGC Cys UGA STOP UGG Trp protein. U CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro ССС Pro CCA Pro CCG Pro CAU His CAC His CAA Gln CAG Gln CGU Arg CGC Arg CGA Arg CGG Arg AGU Ser AGC Ser AGA Arg AGG Arg AAU Asn AAC Asn AUU lle AUC lle AUA lle AUG Met ACU Thr ACC Thr ACA Thr ACG Thr A AAA Lys AAG Lys GUU Val GUC Val GUA Val GUG Val GCU Ala GCC Ala GCA Ala GCG Ala GAU Asp GAC Asp GAA Glu GAG Glu GGU Gly GGC Gly GGA Gly GGG Gly UCAGTranslate the following DNA sequence into a sequence of amino acids: TAC TAA GGA. The genetic code Second letter of codon UAU UUU Phenylalanine UCU UUC Phe) Tytosine (Tyr) UGU Cysteine (Cys) UGC UCC Serine (Ser) UCA UCG CCU UAC UA Stop codon UXG Stop codon 1oG Stop codon UGS Tryptophan (Trp) CGU CC UUA Leucine (Leu) UUG CAU Histidine (His) CAC CUC Leucine (Leu) CUA Proline (Pro) CA Arginine (Arg) CAR Glutamine (Gin) CGA CUG AUU AUC AUA CAG AAU AAC ACU Isoleucine (le) Asparagine (Asn) AGU Serine (Ser) ACC Threonine (Thr) ALA ARC GAU GAC ACA ACC GCO Methicnine: Lysine (Lys) AGA Arginine (Arg) AGS start codon GUU Aspartic acid (Asp)GGU GUC Valine (Val) GUA GCC Alanine (Ala) GO Glycine (Gly GCA GCG GAA Glutamic acid (Glu) GGA GUG GAG GGG methionine-isoleucine-proline. AUG AUU CCU UAC UAA GGA tyrosine-leucine-glycine First letter of codon Third letter of codonIf DNA segments changes from GCATAG to GCATGG, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base A G UUU1 Phenylalanine UCUT UAUT FTyrosine (Tyr) UAC UGU, U FCysteine (Cys) UGCJ UUCJ (Phe) UCC Serine (Ser) UCA U UGA - Stop A UUA1 FLeucine (Leu) UUG- UAA1 FStop UAGJ UCG- UGG - Tryptophan (Trp) G CUU CAU1 CCU1 CGUT Histidine (His) CAC- CUC CCC Proline (Pro) CCA CGC FLeucine (Leu) CUA FArginine (Arg) CGA CAA1 Glutamine A CAGJ (Glu) CGG- CUG- CCG- ACU AAUJ Asparagine AUUT AGUT FSerine (Ser) AGC- U AUC FIsoleucine (lle) ACC AACJ(Asn) Threonine A AUA- (Thr) AAA1 FLysine (Lys) AAG- АСА AGA, FArginine (Arg) AGG- A Start Methionine AUG- (Met) ACG- G GUU GCU, GAU1 Aspartic Acid GGU U GAÇJ(Asp) GUC Fvaline (Val) GUA GCC GGC G Alanine (Ala) GCA Glycine (Gly) A GAAJ Glutamic Acid GGA GAG- (Glu) GUG- GCG- GGG- G
