Below is the 5'-3' strand of a double-stranded DNA molecule with the following nucleotide sequences: 3' 1. If the above DNA strand is the coding (sense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription? 5' CCTATGCAGTGGCCATATTCCAAAGCATAGC 2. If the RNA synthesized above (item #1) is a functional mRNA and all the nucleotides belong to an exon, a. how many codons are present in this mRNA? b. how many codons actually code for proteins in this mRNA? c. what stop codon is present in this mRNA? 3. If the above DNA strand is the template (antisense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription? 4. If the RNA synthesized above (item #3) is a functional mRNA and all the nucleotides belong to an exon, a. how many codons are present in this mRNA? b. how many codons actually code for a protein in this mRNA? what ston codon is present in this mRNA?

Q: Put the molecules in the right category for Cellular Respiration Reactants (What goes IN to the…

A: This is the reaction of Cellular Respiration where oxygen is combined with the food molecules by the…

Q: Is this type of ETi sweets harmful? Wale "up wafer with COCoa cream

A: Is the sweets like water with cocoa cream harmful?

Q: Compounds found in food that the body cannot manufacture O Proteins and fats Carbohydrates and water…

A: Q. Compounds found in food that the body cannot manufacture   Q. bacillus incubation period of 4-12…

Q: ER 1ZER TIZER GEL

A: Neurons or nerve cells form the structural and functional unit of the brain and spinal cord. Neurons…

Q: Gioe beovres die/ge drde or rlaun HG- tikad Alaa ktat Tiwan prdar cal lele steat i Aart atoe…

A: Since we only answer one question at a time, we’ll answer the first one (flow chart). Please…

Q: 7) Assume for the below punnett square that the following alleles are in use. XC = color blindness…

A: X linked disorder means those disorder that are associated with X chromosomes.  Female has two X…

Q: What are they? Can you answer it?

A: They are different types of cells present  in body such as blood cells, bone cells and muscle cells…

Q: PRODUCTS, IS A SOURCE OF PECTIN SUBSTANCES 1. milk 2. apple, plum 3. bakery products and cereals 4.…

A: Pectin is a polysaccharide present mainly in the cell walls and non woody parts of terrestrial…

Q: A BCD A B C D Look at the two gels above and choose the correct interpretation of the banding…

A: DNA bands can be compared in gel electrophoresis by comparing the suspect's DNA bands with the…

Q: IDENTIFY THE ARCUATE ARTERY

A: The kidney is a vital organ that performs many functions, one of the most important being the…

Q: 1. Explain the difference between a WBC count and a differentialcount in terms of what information…

A: Hello, as your question has many parts, we will only answer the first three parts for you and if you…

Q: I forgot to add answer D which is all of the above.

A: Hormones primarily play a regulatory role in the body by influencing various physiological…

Q: Identify the following muscles: 1 What is the group of muscles on the posterior thigh? 2 What muscle…

A: Due to our answering policy, we can only answer one question at a time. Kindly post the other…

Q: what might be the possible cause of the mobile bay jubilee ? Can you write the answer in 7th grade…

A: Jubilee is the name given to a natural occurrence that happens on the shores of Mobile Bay on…

Q: Please help, i need this to study, i dont get it, make the answer clear

A: muscle contraction is basically the shortening of sarcomere , these are the units of myofibrils with…

Q: I am having trouble with these qustions can you help

A: We are answering all parts of first image . For second  image kindly repost.

Q: 1. Transcription: Write out the sequence of mRNA that would result from transcription of the…

A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…

Q: Would you like to eat? Yes, l'd love. This (10 sentence grammatically is True .a False .b

A: Yes this sentence is  right grammatically. There is no error in this sentence but it can be more…

Q: 21 PS 2F ZS E 22

A: This picture is of Cell division (Anaphase)  Mitosis is a type of cell division in which a cell…

Q: Could you please help me with a care plan for this patient? NANDA for safety for someone pulling out…

A: Approach to solving the question: Detailed explanation: Examples: Key references:Perry, A. G.,…

Q: I need help to Label the structures.

A: Tonsils are part of the lymphoid system. They are the lymph nodes that are located at the back of…

Q: z1 PS z2

A: Centrioles play a significant role in cell division.  They help in formation of  spindle fibers and…

Q: Help please let me answer

A: We know that Lymphatic vessels are a network of capillaries and a huge network of tubes that move…

Q: are there any other methods you can also use?

A: There are several methods to determine whether a gene is expressed or not. Here are some commonly…

Q: スイ PS スF CHT Z5

A: Step 1 Every cell has the power to grow and divide to form new cells of the same kind. At the time…

Q: What do their comments mean, with respect to their functions in our bodies?

A: Organ system/ body system is a system which is formed by various organs.   Organ system in human…

Q: the aduwantage W hat of Jean Watson Aurgina Theory are on Pahrent A Family ?

A: Nursing care is the field of clinical practice of administration of drug ,patient counselling and…

Q: In The Day of the Triffids, after most people in the world are blinded by an apparent meteor shower,…

A: The alleles are generally of dominant and recessive type and some other forms like codominant are…

Q: Hi there! This always confuses me. Would you be able to help?

A: Mitosis and meiosis, the two types of cell division. Mitosis is a fundamental process for life.…

Q: Identify the specific strata of the epidermis indicated as A Identify the specific strata of the…

A: Skin consists of outer layer epidermis, middle layer dermis and inner layer hypodermis. Epidermis is…

Q: The patient will more than be placed on another medicallon Can you anything that you could do as an…

A: *Medical assistants are healthcare professionals that assist doctors in clinics and offices. *They…

Q: What is the Fischer projection of the nonulose structure above? H OH H OH HOH HOH H OH HOH H OH HOH…

A: The fischer projection of given nonulose structure is..  fischer projection is 2-D image of 3-D…

Q: Please I need help understand which it is

A: Hormones are chemical compounds that are usually released by endocrine glands of the body and have a…

Q: How does the drug interfere with the normal function of the neurotransmitter(s)? What effects are…

A: Drugs are usually used as medicines to help pateints to cope with illness like insomnia, depression,…

Q: Could you please advise?

A: Connective tissue is one of the major tissue types present in the human body.

Q: FOODS RICH IN VITAMIN «K» 1. fish 2. carrots,tomatoes 3. meat 4. milk

A: Introduction Vitamin K, the generic name for a group of substances with the chemical formula…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.