DOWNLO T O- : Tools 4. In your own words, write a brief description of the events that occur in each of the following organelles during the process of protein synthesis. In your answer, be sure to include the following terms: DNA, m RNA, TRNA, codon, amino acid, protein In the nucleus: In the ribosome:

DOWNLO T O- : Tools 4. In your own words, write a brief description of the events that occur in each of the following organelles during the process of protein synthesis. In your answer, be sure to include the following terms: DNA, m RNA, TRNA, codon, amino acid, protein In the nucleus: In the ribosome:

Anatomy & Physiology

1st Edition

ISBN:9781938168130

Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble

Publisher:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble

Chapter3: The Cellular Level Of Organization

Section: Chapter Questions

Problem 4ILQ: Watch this video (http://openstaxcollege.org/l/ribosome) to learn about ribosomes. The ribosome...

See similar textbooks

Similar questions

QOD #6 Directions: Label the illustration below using the following terms: MRNA, ÉRNA, rRNA/ribosome, transcription, translation, codon, polypeptide chain/protein. Each term will only be used once.
topic: translation how is the growing polypeptide released from the ribosomal assembly?
try w1 II. In each of the following DNA sequences, write on your answer sheet the corresponding mRNAtranscript and use the genetic code to determine the resulting amino acid sequence. Note that the givenstrands are in the 3’ to 5’ direction. Start the amino acid sequence with the start codon and end withstop codon.1. TTTTACCATCCCACAATTTA mRNA: _________________________ Amino acids: _____________________ 2. ACTACTTTCAGAGCTATATTCAG mRNA: _________________________ Amino acids: _____________________
From DNA to Protein 3D what is the location in the cell or organelle where these processes occur, the main enzymes and substrates for each process, details about initiation, elongation, and termination of each process.
Concept Overview: Protein Synthesis Task 2: Review the process of protein synthesis by placing the cards in their appropriate category. Think before you drop - This is an all or nothing type of question. Double check that you are happy with where you placed all of the options before you submit the knowledge check. Transcription Translation No Answers Chosen No Answers Chosen Transcription & Translation Neither No Answers Chosen No Answers Chosen Possible answers DNA is copied into MRNA Involves tRNA | Occurs in the mitochondria Information in MRNA is used to produce a protein Occurs in the nucleus Involves mRNA Utilizes ribosomes Involves DNA polymerase Involves RNA polymerase Occurs in the cytoplasm :::: :::: ::::
SAY IT WITH DNA: PROTEIN SYNTHESIS WORKSHEET: Practice Pays Student Handout Having studied the process by which DNA directs the synthesis of proteins, you should be ready to decode some DNA "secret" messages. To do this, you must follow the procedure of protein synthesis as this is taking place right now in your cells; no short cuts! Practice these steps by following and finishing the partially solved message below. STEP 1: "Build" the mRNA molecule, matching the RNA nucleotides to the DNA nucleotides properly, letter by letter. (For purposes of simplicity, it will be assumed that this mRNA is bacterial; there are no introns to cut out!) STEP 2: Figure out the tRNA triplets (codons) that would fit the mRNA triplets (letter by letter). STEP 3: Look up each tRNA codon in the tRNA Dictionary (below), and find the corresponding symbol and amino acid abbreviation for that codon. Record that one-letter symbol (and its amino acid) below each codon. "Spc" = "space". If you have done this…
Directions: Transcribe the DNA sequence in the space provided. Use your notes and what you know. Remember, what pairs with A? With C? DNA sequence: ACСА СТА ССТ СТС АТT MRNA sequence: UGU GAU Directions: Now use the codon chart to translate the mRNA sequence into an amino acid chain. Second letter A G UUUPhe UAU Tyr UCU UCC UCA UCG UGU UGCCYS UAA Stop UGA Stop A UUC UAC Ser UUA UUG Leu UAG Stop UGG Trp G CAU CGU] CUU CUC CUA CUG CCU CCC CCA CCG His CAC CAA Gin CGC Leu Pro CGA Arg A CAG CGG AAU Asn ACU ACC ACA AUG Met ACG AGU ser AGC AGA Arg AUU AUC Fle AAC Thr AUA AAA AAGLYS AGG. G GGU GGC GCU) GAU GUU GUC GUA GUG GAC Asp GAA GCC Ala GCA Gly Val GGA A GCG Glu GGG GAG, Amino acid sequence:Cys + Asp First letter Third letter
point: Gene expression and gene regulation - Google Chrome 1/mod/quiz/attempt.php?attempt=D1168284&cmid=3372885 5. uc The following segment of DNA codes a protein. The uppercase letters represent exons, the lowercase letters red introns. Draw the pre-mRNA, the mature mRNA and translate the codons using the genetic code to form th protein. Identify the 5'UTR and 3'UTR. out of 5'-AGGAAATGAAATGCCAgaattgccggatgacGGTCAGCaatcgaGCACATTTGTGATTTACCGT-3" g question A B. 三 X2 =三三囲 Y pre-MRNA:| I囲2 L
Describe the process of translating mRNA into proteins. Be sure to also include the following key terms: tRNA, ribosomes, codon, base pairs, cytoplasm, amino acids.
Watch this video (http://openstaxcollege.org/l/ribosome) to learn about ribosomes. The ribosome binds to the mRNA molecule to start translation of its code into a protein. What happens to the small and large ribosomal subunits at the end of translation?
A crime has occurred, and you are asked to help solve it. A forensics detective brings you a sample from the crime scene of what they believe is the suspect's DNA and asks you for chemical analy Your study of this sample reveals the presence of adenine, thymine, ribose, and uracil, leading you to conclude that the sample is A pure DNA probably a mixture of DNA and RNA C pure RNA probably a mixture of rRNA and mRNA MAR 12 tv MacBook Air DII DD esc F6 F7 F8 F9 F10 F1 F1 F2 F3 F4 F5 &
I need help determining which part of the DNA and RNA(?)molecules are which. I'm also unsure of what translation and transcription are. Word bank: amino acid, protein, anticodon, mRNA, tRNA, codon, ribosome(used), DNA(used) Thank you so much!!