DNA sometimes has chemical groups attached, called methyl groups, that affect gene expression. Suppose that, during each hour, first a fraction m of unmethylated locations on the DNA become methylated, and then a fraction u of methylated locations become unmethylated. Find a recursion for the fraction f of the DNA molecule that is methylated.

Q: Which of these two changes is more difficult for DNA repair enzymes to fix correctly? Explain why.

A: DNA ( deoxyribonucleic acid) acts as the genetic material  of almost all the living organisms. DNA…

Q: With a few exceptions, interspersed repetitive DNA in the human genome has no known biological…

A: Human genome: The term human genome refers to the complete set of genetic instructions or DNA that…

Q: Describe the banding pattern seen in the gel. What does that tell you about the role of annealing…

A: Gel electrophoresis is a laboratory technique for separating charged molecules such as DNA, RNA, and…

Q: Recombination signal sequences are conserved heptamer and nonamer sequences that flank the V, J, and…

A: Introduction: RAG 1 & 2 are the recombination activating genes that encode a portion of a…

Q: 5. 2) Digestion of a 1.1kb fragment of plasmid DNA with BamHl produces two fragments of 700 bp and…

A: BamHI is a type II restriction endonuclease can identify specific restriction site and induce cut on…

Q: 23. Design the forward, reverse, and internal primers to the gene below and mutate the…

A: Primers are stretches of nucleic acids (either DNA or RNA) that help in DNA replication. DNA…

Q: Why are some transposons medically important?

A: Certain sequences are repetitive such as satellite DNA, transposable elements, etc. They are studied…

Q: What fraction of the binturong genomic DNA would be considered to be "highly repetitive" DNA, based…

A: DNA is a molecule composed of two polynucleotide chains that coil around each other to form a double…

Q: A method for detecting methylated CpGs involvesthe use of a chemical called bisulfite, which…

A: Hi! Since you have posted multiple questions, we are answering only first three sub-parts. Primers…

Q: Based from Fig. 1B, which of the following lanes contain a good quality genomic DNA? Bad quality…

A: Agarose Gel electrphoresis is done to segregate the DNA bands according to its size. The size can be…

Q: 100 50 104 1 10 104 Cot DNA renaturation curves occasionally show three distinct phases of…

A: A single stranded DNA binds to its complementary strand to reform double stranded DNA is called…

Q: Although DNA polymerases require both a template and a primer, the following single-stranded…

A: DNA polymerases require both a template and a primer to synthesize DNA. However, some…

Q: What two basepair changes can occur when G tautomerizes to the enol form? Recall that the…

A: Introduction: Spontaneous mutations result from numerous sources such as errors during DNA…

Q: Fig 3.16 EcoRI SacI Kpnl ampR Aval Xmal Smal lacZ BamHI Xbal Sall AccI HincII PstI Sphl HindIII Bam…

A: A bacterial protein termed restriction enzyme, also known as molecular scissors, cleaves DNA at…

Q: Can you please help with 1d please  picture with 1 graph is for question 1a) picture with 4 graphs…

A: Binturong or the bearcat is found in South and Southeast Asia. It is declared as vulnerable,…

Q: The structure of a typical pUC19/human DNA recombinant clone. Ensure that you clearly indicate the…

A: Plasmid vectors are circular and extra chromosomal DNA which are capable of self-replication.…

Q: Below are some actual alleles of the gene for phenylalanine hydroxylase enzyme. What is shown for…

A: Alleles are the alternative form of a gene. The alleles codes for the different versions of a…

Q: Assume that a DNA sequencing reaction is carried out, except that the four different…

A: Ans: DNA sequencing: It is the process of knowing the sequence of the DNA. The DNA sequencing is of…

Q: The genomic DNA of an organism has a base composition of 60% C-G base pairs and 40% A-T base pairs.…

A: DNA stands for deoxyribonucleic acid. It is a genetic material. It is present in the nucleus and…

Q: Draw the structure of the double Holliday junctionthat would result from strand invasion by both…

A: Holiday junction are intermediates of homologous recombination and this junction formation occur…

Q: Take a look at question 3 in More Genetic TIPS. Let’s suppose amale is heterozygous for two…

A: Polymerase chain reaction, or PCR , is a technique to make many copies of a specific DNA region…

Q: THE MOLECULAR GENETICS OF CYSTIC FIBROSIS The following is the base sequence of DNA that codes for…

A: According to our guideline we can answer only first 3 subparts of a question. So, upload rest of the…

Q: 1. What is the minimum number of DNA nucleotides in this whole gene? 2. What is the sequence of…

A: Sickle cell anemia is a disease caused by a mutation of the gene coding for hemoglobin leading to…

Q: Can you please help with 1c please  picture with 1 graph is for question 1a) picture with 4 graphs…

A: We know that E. coli is a prokaryote and Binturong is a eukaryotic animal. On studying the DNA…

Q: The 3′ → 5′ exonuclease activity of Pol I excises only unpaired 3′-terminal nucleotides from DNA,…

A: A technique discovered by Kary Mullis, polymerase chain reaction (PCR), is used to replicate the DNA…

Q: Identify two major functions of DNA pol III in DNAreplication.

A: DNA replication is the natural cycle of producing two indistinguishable replicas of DNA from one…

Q: Are you a hidden heterozygote? A PCR analysis (part2) Agarose gel electrophoresis and interpretation…

A: Agarose gel concentration  More the concentration of the agarose gel more smaller will be its pores.…

Q: d. Between which two regions on the DNA will the polyadenylation signal be found? Use the numbers to…

A: Deoxyribonucleic acid is also known as DNA and ribonucleic acid also known as RNA are two types of…

Q: What part(s) of a nucleotide (namely, phosphate, sugar, and/orbase) is(are) found in the major and…

A: Nucleotides are composed of a phosphate group, a pentose sugar, and a nitrogenous base. The pentose…

Q: In the genome of Zea mays, in the segment 120M to 120,030k of Chromosome 5, what repeat elements do…

A: A monoecious plant has male and female flowers on the same plant, or flowers that have both male and…

Q: Can you please help with 1c please  picture with 1 graph is for question 1a) picture with 4 graphs…

A: We know that E. coli is a prokaryote and Binturong is a eukaryotic animal. On studying the DNA…

Q: Why DNA methylation needed for DNA replication ? * Your answer What is the general way for…

A: 1.  DNA methylation is the process of adding a methyl group to the DNA sequence. It helps in…

Q: 5'-TTAGGGAACCCTCACTGAATGAATGAATG AATGAATGAATGAATGAATGAATGAATGAATGTTTGGGCAAATAAACGCTG-3' Re-type (or…

A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via…

Q: How would I calculate sanger sequencing fragments that will produce green

A: Sanger sequencing is a method used to determine the sequence of DNA by incorporating…

Q: 5' 3' O Top strand 5' O Bottom strand Primer 1 ORF Primer 2 5' 3' You have designed primers to…

A: In DNA, the two strands are antiparallel, meaning they run in opposite directions. The top strand…

Q: 1c) What fraction of the binturong genomic DNA would be considered to be "highly repetitive" DNA,…

A: Deoxyribonucleic acidi an atom made out of two polynucleotide chains that curl around one another to…

Q: THE MOLECULAR GENETICS OF SICKLE CELL ANEMIA The following is the base sequence of DNA that codes…

A: Note: You have asked multiple sub part questions but as per our instructions we are instructed to…

Q: Look at Figure 17-22 and state which bands are missing in the cri du chat deletion.

A: Cri-du-chat syndrome- It is also known by the name of 5p-syndrome, It is basically a chromosomal…

Q: Can you please help with 1c please  picture with 1 graph is for question 1a) picture with 4 graphs…

A: We know that E. coli is a prokaryote and Binturong is a eukaryotic animal. On studying the DNA…

Q: 5' 3' ORF for gene X +1 ou find a mutation elsewhere in the genome (not within the sequence above)…

A: The genetic information encoded in DNA is transformed into a complementary RNA molecule during the…

Q: Homologous recombination in E. coli forms heteroduplex regions of DNA containing mismatched bases.…

A: Heteroduplex : It is a double stranded molecule of nucleic acid originated through the genetic…