Homework Help is Here – Start Your Trial Now!
Science
Biology
DNA is alway DNA mRNA 5' aal 3 51 PROMOTER AACGCATACGGGATAGCGCCCTGGTTCAAATGGCGGGCCGGCATCCC TTGCGTATGCCCTATCGCGGGACCAAGTTTACCGCCCGGCCGTAGGG 4 6 8 9 0 Step 2. Use one of the genetic code charts below to translate the mRNA above into its corresponding protein. Record the amino acid sequence that this mRNA codes for in the boxes provided. Remember that the START CODON is AUG. aa2 aa3 aa4 ааб aa7 aa8 aa5 aa9 aa10 5' 3' aall aa12

DNA is alway DNA mRNA 5' aal 3 51 PROMOTER AACGCATACGGGATAGCGCCCTGGTTCAAATGGCGGGCCGGCATCCC TTGCGTATGCCCTATCGCGGGACCAAGTTTACCGCCCGGCCGTAGGG 4 6 8 9 0 Step 2. Use one of the genetic code charts below to translate the mRNA above into its corresponding protein. Record the amino acid sequence that this mRNA codes for in the boxes provided. Remember that the START CODON is AUG. aa2 aa3 aa4 ааб aa7 aa8 aa5 aa9 aa10 5' 3' aall aa12

Human Anatomy & Physiology (11th Edition)
Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:Elaine N. Marieb, Katja N. Hoehn
Chapter1: The Human Body: An Orientation
Section: Chapter Questions
Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...
See similar textbooks
icon
Related questions
Question

I need help with the Build The Protein section

 

Nitrogen Bases Complementary Base Pairs DNA 5' mRNA Location in the cell aal ATCG Pairs A+T C+ 6 Strands Z Strands nucleus BUILD THE PROTEIN BLOCK DAY Part A - Practice: The Transcription & Translation of a DNA Gene Sequence. Directions: Use the supplied DNA template strand to complete the activity below. Step 1. A DNA gene sequence is shown below. Correctly transcribe the template DNA strand into the mRNA strand boxes. Remember that the promotor region of the DNA tells the enzyme, RNA Polymerase, in which direction to read the DNA template, and that the template strand of DNA is always read in a 3' to 5' direction. 3 51 AUCE A+U C+G Single Stand Ribosomes / nucleus 1 1 Normal thymine (T) is found in the old strand. It is replaced by an abnormal molecule (T*) in the new strand. The abnormal molecule (T*) binds to guanine (G) instead of binding to adenine (A). This is an example of A an adaptation TWO DNA SEGMENTS 2 aa5 2 3 B protein synthesis Ca mutation D binary fission 2 2 3 Old strand New strandt aa9 CIC AACGCATACGGGATAGCGCCCTGGTTCAAATGGCGGGCCGGCATCCC TTGCGTATGCCCTATCGCGGGACCAAGTTTACCGCCCGGCCGTAGGG G 3 CIC CIC с T CA 1 GT C 1 1 с C G G 3 aalo 1 G T fo î November 2/3 1 he Step 2. Use one of the genetic code charts below to translate the mRNA above into its corresponding protein. Record the amino acid sequence that this mRNA codes for in the boxes provided. Remember that the START CODON is AUG. aa2 aa3 aa4 aa6 aa7 aag 5' 3' aall se p W aa12 1552
Transcribed Image Text:Nitrogen Bases Complementary Base Pairs DNA 5' mRNA Location in the cell aal ATCG Pairs A+T C+ 6 Strands Z Strands nucleus BUILD THE PROTEIN BLOCK DAY Part A - Practice: The Transcription & Translation of a DNA Gene Sequence. Directions: Use the supplied DNA template strand to complete the activity below. Step 1. A DNA gene sequence is shown below. Correctly transcribe the template DNA strand into the mRNA strand boxes. Remember that the promotor region of the DNA tells the enzyme, RNA Polymerase, in which direction to read the DNA template, and that the template strand of DNA is always read in a 3' to 5' direction. 3 51 AUCE A+U C+G Single Stand Ribosomes / nucleus 1 1 Normal thymine (T) is found in the old strand. It is replaced by an abnormal molecule (T*) in the new strand. The abnormal molecule (T*) binds to guanine (G) instead of binding to adenine (A). This is an example of A an adaptation TWO DNA SEGMENTS 2 aa5 2 3 B protein synthesis Ca mutation D binary fission 2 2 3 Old strand New strandt aa9 CIC AACGCATACGGGATAGCGCCCTGGTTCAAATGGCGGGCCGGCATCCC TTGCGTATGCCCTATCGCGGGACCAAGTTTACCGCCCGGCCGTAGGG G 3 CIC CIC с T CA 1 GT C 1 1 с C G G 3 aalo 1 G T fo î November 2/3 1 he Step 2. Use one of the genetic code charts below to translate the mRNA above into its corresponding protein. Record the amino acid sequence that this mRNA codes for in the boxes provided. Remember that the START CODON is AUG. aa2 aa3 aa4 aa6 aa7 aag 5' 3' aall se p W aa12 1552
Expert Solution
steps

Step by step

Solved in 2 steps

SEE SOLUTIONCheck out a sample Q&A here
Blurred answer
Knowledge Booster
Genomics
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
  • SEE MORE QUESTIONS
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:
9780134580999
Author:
Elaine N. Marieb, Katja N. Hoehn
Publisher:
PEARSON
Biology 2e
Biology 2e
Biology
ISBN:
9781947172517
Author:
Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:
OpenStax
Anatomy & Physiology
Anatomy & Physiology
Biology
ISBN:
9781259398629
Author:
McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:
Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:
9780815344322
Author:
Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:
W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:
9781260159363
Author:
Martin, Terry R., Prentice-craver, Cynthia
Publisher:
McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Inquiry Into Life (16th Edition)
Biology
ISBN:
9781260231700
Author:
Sylvia S. Mader, Michael Windelspecht
Publisher:
McGraw Hill Education
SEE MORE TEXTBOOKS