Q: A DNA sequence such as the one shown below has symmetry.
A: In this question the DNA sequence the reading in one strand (5' - 3') is same in complementary…
Q: If the DNA sequence is ATG-CGT, the mRNA codons are ___. ATG-CGT UAC-GCA GUA-CGU AUG-CGU…
A: DNA full form is deoxyribonucleic acid. DNA is the main constituent of the chromosome. It contains…
Q: sigma factor: promoter as O protein: DNA O mRNA: tRNA -35 element: GATCC element O elongation:…
A: Transcription is the process of making an mRNA copy of a gene (DNA). It is catalyzed by an enzyme…
Q: 5. The image below is a mRNA message. Please draw a ribosome translating the message below. Draw the…
A: Solution: the required labelled image is provided in the image attached below:
Q: 5. A DNA sequence of "ACG" will code for the amino acid - (LS1- 1) * Second mRNA base C. UUU Phe UUC…
A: Gene expression refers to the complex, highly-regulated biological process, which involves the…
Q: Chapter 17: If given the following coding strand of DNA, what is the MRNA? What TRNA will be…
A: There are two types of nucleic acids present in the cells- DNA and RNA. DNA carries the genetic…
Q: The structure below is a fragment of what molecule? NH₂ NH, OP.OCH, OPOCH, oroc, QPOCH, O DNA ORNA O…
A: There are two kinds of nucleic acids DNA and RNA. DNA is double started molecules and RNA is a…
Q: GCTA A AAG GCG
A: Transcription is the process of copying a segment of DNA into RNA. The segments of DNA transcribed…
Q: Normal Strand: DNA: GCA ATG CAC MRNA: Amino Acids:
A: A frameshift mutation is a genetic mutation. It is caused by indels of the number of nucleotides in…
Q: 1. T DNA strand NUCLEUS MRNA CU CYTOPLASM 6. 5. Lysine 7. AAGUUU UGUUCA AA 4. 2.
A: CENTRAL DOGMA- Replication is the process when DNA replicates itself means it will make copies of…
Q: 4. Compare the DNA sequences of individuals with Alzheimer's disease and their family members. Two…
A: The amyloid beta precursor protein (APP) is coded by the APP gene that is located on the chromosome…
Q: Original DNA Sequence: T A C A C C T T G G C G A C G A C T … mRNA Sequence: Amino Acid Sequence:
A: CENTRAL DOGMA- Replication is the process when DNA replicates itself means it will make copies of…
Q: Page 5 of 10 761 words mana M m X English (United States)
A: This question is about labelling the diagram of a cell.
Q: 1. Label the diagram below with the following terms: O DNA Ribosome MRNA Transcription tRNA…
A: Transcription and translation are the components of gene expression. These two processes are known…
Q: 5. What proteins help to direct the RNA Polymerase to the right location?
A: Transcription occurs in three steps namely initiation, elongation, and termination. The initiation…
Q: Nucleotides - U - T -Sugar & Phosphate - Anticodon - Codon - Ribose - Transcription -…
A: The central dogma consists of DNA to DNA (Replication) DNA to RNA (Transcription) RNA to proteins…
Q: A codon consists of _ bases and specifies which will be inserted into the polypeptide chain. 4,…
A: The codon defines the relationship between a nitrogenous base sequence and the corresponding…
Q: How does a DNA molecule produce copies of itself? O replication O expression O translation O…
A: The production of new DNA from old DNA is known as replication process. The DNA replication occurs…
Q: Codons are recognized by O DNA polymerase and a codon O FRNA and a codon O TRNA and an anticodon O…
A: Codon is a sequence made of DNA or RNA which corresponds to a particular amino acid.Genetic code is…
Q: Chains of nucleic acids have directionality and are read in a certain way just like languages are…
A: DNA is the molecule that carries genetic information and is found in nearly all living organisms. It…
Q: THCA 100 This reaction is Entropy is THC ( Leafly Mur AD RNA polymerase ATGACGOATCAGCCOCAAG…
A: Tetrahydrocannabinol Acid when heated converts into delta-9-tetrahydrocannabinol. the reaction is…
Q: 26. Using the following DNA strand, write out the mRNA, and then the amino acids. DNA: 3' T- A- C-…
A: Since we only answer one question at a time, we’ll answer question 27 (as you have already solved…
Q: Which of the following is not a factor in the lifetime of a protein? ANSWER Ubiquitination…
A: Proteins are unbranched polymers constructed from 20 standard α-amino acids. They have four levels…
Q: 2. DNA Template: TTA - CAT - CAT - ATC - GAT - GAC mrNA: tRNA: Amino acid sequence:
A: All cells divide to give rise to new cells at some specific stage of their life or throughout. The…
Q: II. Use the eukaryotic gene DNA sequence below to answer the following questions: 1 11 21 CGACTTACTG…
A: Introduction Codons are units of genomic information made up of three nucleotides (trinucleotides)…
Q: DNA: AGA ACA TAA TAC CTC TTA ACA CTC TAA AGA CCA GCA CTC CGA TGA ACT GGA GAC…
A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…
Q: which does not play a role in translation?
A: The translation is the process in which the message coded by an mRNA is translated into a sequence…
Q: Amino acids are joined together into a protein chain by which of the following? * DNA polymerase…
A: Proteins are essential molecules in the living system. All the physiological and cellular processes…
Q: 1: Transcription Transcription DNA nucleotides TAC АСА GAT TTT GTC ACT АТА MRNA codon AUG
A: The method of producing an RNA copy of a gene sequence is known as transcription. This duplicate,…
Q: ACA www GAC GGG TTA CC AAG GTT TAG ATC ТАС Coding strand-DNA Template strand-DNA MRNA-codons…
A: * DNA consists of four nucleotides They are Adenine Guanine Thymine Cytosine *RNA consists of…
Q: TRANSLATION
A: Central dogma: This theory states that the DNA contains instructions for making a protein which are…
Q: 1. In the DNA sequence, the bottom strand is a template strand. If the base pair G-C (in bold) is…
A: Transcription is a process which involves formation of RNA molecules from DNA. One of the DNA strand…
Q: Consider the image of protein synthesis (translation). Identify the two different RNA molecules…
A: Translation refers to the process of protein synthesis. It falls under the process of gene…
Q: What process occurs before the other? Transcription and then lonization Translation and then…
A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…
Q: 7 Which of the following is the correct polypeptide chain for the mRNA strand shown below?…
A: The polypeptide is formed by the process of the translation process, where mRNA carries codons…
Q: Given the DNA sequence, transcribe it to MRNA, and then find the appropriate Amino Acid. Type your…
A: Codon is described as a sequence of three nucleotides that form a unit of genetic code in…
Q: The found in the MRNA is complementary to the found in the TRNA. O anticodon, anticodon O anticodon,…
A: Introduction Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum…
Q: 4)Which of the following have codons? Choose all that apply DNA RNA polymerase proteins tRNA…
A: Codons are the set of three nucleotides which encode a particular amino acid.
Q: 2. Below is a short segment of a DNA molecule. Translate the DNA codon into MRNA.…
A: The double-helical structure of DNA was transcribed into mRNA molecules and these mRNA molecules are…
Q: DNA template strand: mRNA codons: tRNA anticodons: polypeptide: 3' end 5' end AGC TTG □ TCC 0 0 0…
A: The method of converting DNA into proteins includes two major steps: transcription and…
Q: What joins different amino acids and used peptide bonds. mRNA rRNA tRNA All of the above
A: RNA (ribonucleic acid) molecules are a type of nucleic acid found in cells that are involved in a…
Q: 2. DNA → AGA ACA TAA ATG CTC TTA ACA CTC ATC AGA CCA GCA CTC CGA TGA MRNA > tRNA → protein >
A: During transcription, the DNA of a gene serves as a template for complementary base-pairing, and an…
Q: CODES FOR CRACKING ATG AAG TCA GCT ATT TTA AC DNA CODE 1 CRACKED CODE WHAT IS IT? WHAT DOES IT DO?…
A: Messenger RNA is synthesized by the process called transcription. In this process RNA polymerase…
Q: A particular triplet of bases in the coding sequence of DNA is AAA. The anticodon on the tRNA that…
A: If the template strand of DNA has AAA, it will be transcribed to mRNA as UUU. A tRNA that would…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 1 images
- The genetic code is defined as a series of _______________ in _______________. (a) anticodons; tRNA (b) codons; DNA (c) anticodons; mRNA (d) codons; mRNA (e) codons and anticodons; rRNAIndicate in which category, transcription or translation, each of the following functions belongs: RNA poly-merase, ribosomes, nucleotides, tRNA, pre-mRNA, DNA, anticodon, amino acids.How many amino acids would be in this protein? Which of the five types of nitrogen bases is not found in mRNA
- The following sequence represents triplets on DNA: TAC CAG ATA CAC TCC CCT GCG ACT Give the mRNA codons that correspond with this sequence , and then give the sequence of amino acids in the polypepideMatch each function to the appropriate type of RNA. Messenger RNA (MRNA) Ribosomal RNA (1RNA) Transfer RNA (tRNA) Answer Bank hydrogen bonds with codon transports amino acids to the ribosome catalyzes peptide bond formation contains the coding sequence for the polypeptide sequence. Which may be or is an RNA molecule AGCCTAC GGGCCCA GCCCUUA A & B B & C
- Direction: Study the given amino acid sequence and DNA sequence of the Amino Acid Sequence: LEU-ISC-PRO-PRO-PHE-ILE-LEU-LEU-SER-HIS-LEU-LEU-SER What's More Activity 3.1 Check and Relate listed organisms. Cat DNA Sequence: TTAATCCCCCCGTTTATCCTACTTTCCCATCTACTAAGT Am no Acid Sequence: LEU-ISC-PRO-PRO-PHE-ILE-LEU-EU-SER-ARG-LEU-LEU.AD DNA Sequence: CTTATCCCCCCGTTTATCCTACTTTCCCGTCTACTTCGT Shark Amino Acid Sequence: LEU-ISC-PRO-PRO-PHE-ILE-LEU-LEU-SER-HIS-VAL-VAL-SER DNA Sequence: CTAATCCCCCCGTTTATCCTACTTTCCCATGTAGTAAGT Colphin Amino Acid Sequence: LEU-ISO-PRO-PRO-PHE-LE-LEU-LEU-SER-ARG-LEU-LEU-ARG DNA Sequence: CTAATCCCCCCGTTTATCCTACTTTCCCGTCTACTTCGT Lizard Amino Add Sequence: ISO-4SO ASP-GLN-PHE-ILE-LEU-HIS-SER-ARG-LEU-LEU-ARG DNA Sequence: ATTATCGACCAGTTTATCCTACATTCCCGTCTACTTCGT Sponge Activity Questions: 1. Which organisms are closely related to each other? How are they related? 2. What does this tell us about the organisms and their ancestors? 3. How amino acid sequences and DNA…A particular triplet of bases in the template strand of DNA is 5' AGT 3: The corresponding codon for the mRNA transcribed is O ACU O UUU O UGA O UAC OTCAOriginal DNA Sequence: T A C A C C T T G G C G A C G A C T … mRNA Sequence: Amino Acid Sequence:
- DNA has the sequence GTA. If this were transcribed into mRNA, what would the mRNA codon look like? CAU UUG UAC ATGWhich statement about transfer RNA (TRNA) is NOT correct? Select one: O It folds up into the shape of an L. O It contains modified nucleotides. O It contains a codon at one end, and an anti-codon at the other end. O It is produced by transcription.Which three codons would code for a different amino acid sequence from that coded for by the mRNA base sequence AGU-UCA-CCA? O AGU-UCC-CCG O AGU-UCG-CCC O AGC-UCA-CCU O AGC-UCU-CCU