Chapter 17: If given the following coding strand of DNA, what is the MRNA? What TRNA will be present? (hint - draw this!) DNA: AAACCGATCCTTAATGGCTTA MRNA: TRNA:

Q: How are translation and transcription different?

A: Transcription is the way toward copying a gene DNA sequence to make a RNA molecule and translation…

Q: language nitrogen bases Part 5: Translation - the 2nd step in protein synthesis language (A, U, C,…

A: Transcription is the process in which messenger RNA is synthesized with the help of the instructions…

Q: sigma factor: promoter as O protein: DNA O mRNA: tRNA -35 element: GATCC element O elongation:…

A: Transcription is the process of making an mRNA copy of a gene (DNA). It is catalyzed by an enzyme…

Q: Removal of introns requires a poly-A tail. O a 5' cap. ORNA polymerase enzymes. curling to the…

A: Introduction :- Any nucleotide sequence within a gene that is eliminated during RNA processing to…

Q: Use one of the vocabulary words to fill in the blank. Check your spelling. Key Vocabulary from Unit…

A: The ribosome is a special organelle in the cell that is responsible for protein production. The…

Q: Match the process to the related enzyme/structure in Bacteria. translation [ Choose ] [Choose ] DNA…

A: There are several molecular processes that take place inside the cell. These processes are necessary…

Q: 1. T DNA strand NUCLEUS MRNA CU CYTOPLASM 6. 5. Lysine 7. AAGUUU UGUUCA AA 4. 2.

A: CENTRAL DOGMA-  Replication is the process when DNA replicates itself means it will make copies of…

Q: CHI

A: In translation, tRNA carries specific amino acids according to the codons present on the mRNA. These…

Q: - COMPLETION: Complete the table below, supply the oiven DNA template to its co correct codon and…

A: Introduction:

Q: BONUS: HIV use HIV Reverse Transcriptase to make a double stranded DNA copy of the HIV genetic…

A: A reverse transcriptase is an enzyme which is used for generation of complementary DNA(cDNA) from…

Q: In the DNA  sequence,the bottom strand is a template strand.if the base pair

A: Transcription is the process by which the information in a strand of DNA is copied into a molecule…

Q: After the complete ribosome is assembled, what is the first amino-acyl tRNA to enter the ribosome's…

A: In the process of protein synthesis, ribosomes play a crucial role by facilitating the translation…

Q: Match the following with the correct process. converts DNA into mRNA occurs in the ribosome 1.…

A: All new proteins in the cell are formed by conversion of DNA to amino acids.  conversion of DNA to…

Q: Nucleotides - U - T -Sugar & Phosphate - Anticodon - Codon - Ribose - Transcription -…

A: The central dogma consists of DNA to DNA (Replication) DNA to RNA (Transcription) RNA to proteins…

Q: What are ribosomes composed of? tRNA & proteins mRNA & tRNA rRNA & proteins  mRNA & proteins…

A: The ribosomes are composed of two subunits a smaller and a larger and the sizes of prokaryotic and…

Q: DNA: 5’-CTCTACTATAAACTCAATAGGTCC-3’ -Write the sequence of the RNA molecule that will be…

A: The transcription is the process in which the mRNA copied information from DNA for protein…

Q: ion, mRNA codons, peptide bonds, nucleus.

A: The process of transcription to translation decides the fate of genetic material. Both of the…

Q: TRNA * Carries amino acids in the cytoplasm to ribosomes for protein assembly Amino Acid attachment…

A: The correct answer is (b) amino acid attachment site across from anticodon site on tRNA Transfer…

Q: Which nucleic acid has a double helix structure?     tRNA     mRNA     rRNA     DNA

A: Nucleic acids that are present in the environment can be of two different types based on the type of…

Q: In the diagram below (Figure 22), fill in the terms in the appropriate places indicated by a letter.…

A: This represents central dogma of molecular biology. It shows the flow of genetic information from…

Q: Sequence: AAA UGG CAA   Is the sequence RNA or DNA? How do you know?   Question 1 options:   You…

A: DNA and RNA are are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Q: Step 2- Draw (DO NOT COPY-PASTE Images from the Internet) a picture of what is happening in each…

A: Dr. Francis Crick gave the central dogma of molecular biology which states that the information…

Q: TRANSLATION

A: Central dogma: This theory states that the DNA contains instructions for making a protein which are…

Q: Why siRNA phenomenon is utilized in cell biology? Because specific gene silencing leads to blocking…

A: short double-stranded RNA again about 21-25 bases, would silence the corresponding geneThe RNA…

Q: make(s) proteins while . carry amino acids MRNA : TRNAS ribosomes : TRNAS TRNAS : ribosomes Enzymes…

A: The DNA is the genetic material of the organism like humans. The DNA is transcribed into the RNA by…

Q: Think about replication and transcription in a biological cell. Which process would require ligase…

A: INTRODUCTION DNA ligase This is the enzyme that helps in joining two DNA fragments. This enzyme is…

Q: 5' 2. Explain what indicates the beginning of translation, and what tRNA's role is in translation.…

A: TRANSLATION: The method used by a cell to produce proteins utilizing genetic information conveyed by…

Q: Step 2- Draw (DO NOT COPY-PASTE Images from the Internet) a picture of what is happening in each…

A: Transcription is the process that reads and converts the messages on the DNA template strand into…

Q: AKS 5c: Which of the following answers below accurately describes Strand C in the model? * Strand A…

A: DNA and RNA are both nucleic acids made up of 4 nucleotides connected to each other in particular…

Q: Ribosome is where the Process of translation takes place Process of moving DNA to the cytoplasm…

A: Ribosomes are made up of both proteins and RNA. These are a part of translational machinery present…

Q: MRNE * Once the MRNA gets to the ribosome, it tries to fell the ribosome the message, but it doesn't…

A: According to guidelines we have to answer the first question only. so please kindly post the…

Q: DNA template strand: mRNA codons: tRNA anticodons: polypeptide: 3' end 5' end AGC TTG □ TCC 0 0 0…

A: The method of converting DNA into proteins includes two major steps: transcription and…

Q: Which macromolecule is made by the enzyme reverse transcriptase

A: Option D - cDNA

Q: Match the molecule with its correct description

A: mRNA - Carries a copy of the genetic "message". tRNA  -   Has anticodons Aminoacyl tRNA synthetase -…

Q: DNA RNA Type of sugar Number of strands Nitrogenous bases Location Function Helix (Yes or No)…

A: DNA and RNA are called nucleic acids which are made up of the basic units called nucleotides. A…

Q: RNA polymerase will attach with what sequence(s) and begin to make RNA? Anticodon Promotor stop…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: DNA: GTACGCGTAT ACCGACATIC 4. MRNA: Codon: Anitcodon: A ANO Amino Acids:

A: The sequence of mRNA (messenger ribonucleic acid) is complementary to DNA (deoxyribonucleic acid).…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.