AKS 5c: Which of the following answers below accurately describes Strand C in the model? * Strand A TAČGGCÁŤTÁGAČAAGTGČGÍGÁGTÁCACA Strand B ATGCCGCAATCTGTTCACGCACTCATGTGT Strand CAUGCCGCAAUCUGUUCACGCACUCAUGUGU Met Pro Gin Ser Val His Ala Leu Met Cys Strand C is tRNA. Strand C is only involved in translation. Strand C is DNA. Strand C is part of DNA replication. Strand C is DNA. Strand C is involved only in transcription. Strand C is mRNA. Strand C is involved in transcription and translation.
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
![AKS 5c: Which of the following answers below accurately describes Strand C in
the model? *
Strand A
TACG
CACA
Strand B A
Strand C AUGCO
UGU
Met Pro
Gin
Ser
Val
His
Ala
Leu
Met Cys
Strand C is tRNA. Strand C is only involved in translation.
Strand C is DNA. Strand C is part of DNA replication.
Strand C is DNA. Strand C is involved only in transcription.
Strand C is mRNA. Strand C is involved in transcription and translation.
AKS 5c1: Using codon wheel below, which of the models correctly represents the
Hence of events and.creationof
bacenairing rule +he
O O](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2F13bd36c2-91c3-4d71-a08d-3bd72637e87b%2F9507d9ef-cf10-401a-92ae-20a019fda798%2Fl94x2xa_processed.jpeg&w=3840&q=75)
![](/static/compass_v2/shared-icons/check-mark.png)
DNA and RNA are both nucleic acids made up of 4 nucleotides connected to each other in particular order making long chains. While DNA has nucleotides A, T, G and C, in RNA there is no T and it is replaced with U.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
![Human Anatomy & Physiology (11th Edition)](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
![Biology 2e](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
![Anatomy & Physiology](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
![Human Anatomy & Physiology (11th Edition)](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
![Biology 2e](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
![Anatomy & Physiology](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
![Molecular Biology of the Cell (Sixth Edition)](https://www.bartleby.com/isbn_cover_images/9780815344322/9780815344322_smallCoverImage.gif)
![Laboratory Manual For Human Anatomy & Physiology](https://www.bartleby.com/isbn_cover_images/9781260159363/9781260159363_smallCoverImage.gif)
![Inquiry Into Life (16th Edition)](https://www.bartleby.com/isbn_cover_images/9781260231700/9781260231700_smallCoverImage.gif)