Answered: DNA template strand: mRNA codons: tRNA…

Name: DNA template strand:mRNA codons:tRNA anticodons:polypeptide:3' end5'
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: DNA template strand:mRNA codons:tRNA anticodons:polypeptide:3' end5' endAGCTTGTCCCATCGCACA5' end3' end

Science

Biology

DNA template strand: mRNA codons: tRNA anticodons: polypeptide: 3' end 5' end AGC TTG □ TCC 0 0 0 CAT 0 CGC ACA 000 5' end 3' end

Human Biology (MindTap Course List)

11th Edition

ISBN:9781305112100

Author:Cecie Starr, Beverly McMillan

Publisher:Cecie Starr, Beverly McMillan

Chapter21: Dna, Genes, And Biotechnology

Section: Chapter Questions

Problem 4SQ

See similar textbooks

Related questions

Q: Compare and contrast the nervous organs, special features present in the following vertebrates.…

A: neural System: Generally speaking, fishes have a rather basic neural system. Although they exist,…

Q: What is the difference between the vaginal ring and the IUD? What category does the vaginal ring fit…

A: The term contraception describes techniques or tools used to avoid getting pregnant. Birth control…

Q: Identify at least ten (10) sensory receptors in the eyes, ears, nose, tongue and skin in animals…

A: Sensory receptors are defined as specialized structures or cells in the body which detect and…

Q: what is the mode of action of hexachlorocyclopentadiene in insects

A: HCCP, commonly known as Hexachlorocyclopentadiene, is recognized for its prowess as an insecticide.…

Q: A- Describe the anatomy and physiology of a dog's dewclaw.

A: A dewclaw is a vestigial finger found on the feet of many species. It frequently develops higher on…

Q: During your experiment you analysed only a few of the recombinant clones for the presence of…

A: Genomics is the scientific investigation of an organism's complete or partial genetic or epigenetic…

Q: Question 8 The chiton is a mollusk with a jointed protective shell. It uses its muscular foot to…

A: Chitons are marine mollusks characterized by a unique and distinctive physical feature: a segmented,…

Q: Bacterial have a special amino acid that begins many of their proteins. It is recognized by the:…

A: In bacteria most of the amino acids are in D form. They join with each other via peptide bonds to…

Q: A disease is caused by homozygosity for the g allele (Gis the corresponding wild-type allele).…

A: In the context of genetics, penetration is the percentage of people who really express a…

Q: °In a flock of chickens, rose comb is dominant over the single comb. Approximately 60% of the…

A: The Hardy Weinberg principle referred to as the Hardy Weinberg equilibrium, model, theorem, or law…

Q: 2. Circle the correct bolded blue word. a. A substance that moves across a membrane "down" or "with"…

A: Their are lots of substances whose concentration is higher inside the cell and some of the…

Q: 1. COOOOO G3P -COO ⒸOC-P CCC COO 4 Carbon 4 Carbon ATP 6 C. CITRATE 3. 2. 5 Carbon 4 Carbon CCC…

A: Cell is basically an elemental unit of the body which is involved in various cellular activities.…

Q: Compare and contrast the nervous organs used by the following invertebrates. Complete the table.…

A: Although the neural architecture of invertebrates varies greatly among species, it typically…

Q: CH, H H ОГТІ 0= II Т Н H-C- H₂C-N-C-C-O-P-OC-H CH, H H О 1 H-C-0 -Т Н 2 онннн Н II ТТГ Н Н Н Н Н Н Н…

A: A molecule is the smallest part of any substance that is made up of different atoms connected…

Q: Define LTP at the introduction level (Introduction to Neuroscience College Level).

A: Long-term potentiation, abbreviated as LTP, may be a crucial concept in neuroscience. It alludes to…

Q: Describe, in detail, the stepwise process of mechanoreception for hearing and balance? And, Which…

A: Mechanoreception in the context of hearing and balance involves the detection of mechanical stimuli,…

Q: Intro to Neuroscience Limbic System, Emotion, Reward, and Addiction List the brain regions…

A: The brain regions involved in reinforcement and reward are primarily part of the limbic system and…

Q: You are interested in the expression of regions of the X chromosome at different times in human…

A: The investigation of the X chromosome at different phases of human fetal development is a complex…

Q: Use graph key as guide A cell mitosis experiment in which the cells count is determined hourly over…

A: Thе graph illustrating a cеll mitosis еxpеrimеnt ovеr a 24-hour pеriod rеvеals a compеlling story of…

Q: The RNAi and the microRNA (miRNA) pathways share many components and characteristics. What unique…

A: After being processed and incorporated into the Argonaute proteins which employ them for controlling…

Q: Why is stimulating cells with LPS done for Splenocyte Preparation

A: Any form of white blood cell that is found in the spleen or has been isolated from splenic tissue is…

Q: Prepare a detailed and concise review article linking the viral infection SARS CoV2 (COVID-19) to…

A: In India, a secondary outbreak of a rare fungal contamination known as mucormycosis has been watched…

Q: Describe the molecular interactions that a cell uses to migrate through extracellular matrix. (use…

A: Cell movement through the extracellular matrix (ECM) may be a complex process that includes a series…

Q: Based on the picture, the primary function of molecule #14 in an animal cell is: A. Structural…

A: Urochordates, moreover known as tunicates or sea squirts, are interesting among creatures in that…

Q: To what genus do pigs belong? --Homo --Pisaster --Sus --Suidae --Pan

A: A genus is a taxonomic rank below the family and above the species. It is used to group species…

Q: Calculate the BMI of a woman who is 1.65 m tall and 61 kg in weight

A: BMI ( Body Mass Index) is a measure of body fat by using the body weight (in kilograms or pounds)…

Q: Which of the following sequences would pair best with this sequence: 5'-CGATTCGA-3' O 5'-UCGAAUCG-3'…

A: In DNA, the nitrogenous bases adenine (A) pairs with thymine (T), and cytosine (C) pairs with…

Q: Species SS 1 SS2 SS3 SS4 10 3 2 Whitetail deer 4 Bobcat 1 00 2 White cedar 23 30 110 2 Jumping mouse…

A: The number of individuals of each species of flora and fauna in an area indicates their abundance.…

Q: If guanine makes up 60% of the bases in a DNA double helix, what percent of the bases is adenine?…

A: DNA is a double helical arrangement composed of sets of nucleotides storing genetic information…

Q: Which set of changes to saliva occur as the rate of salivation increases? Group of answer choices…

A: Salivation is the process of producing and releasing saliva into the oral cavity, and it is a…

Q: Deforestation has contributed to erosion and dramatic flooding, particularly in parts of Asia. is…

A: Deforestation, the clearing of forests, is a significant environmental issue with far-reaching…

Q: grams to answer the next 3 questions. (Note: Real-world savannas support more species with r mplex…

A: The correct answer is option c. An increase in Gazelle population size.

Q: Based on the picture, B. What is the primary function of #5 within a cell? A. Form membranes B.…

A: In the picture, the molecule denoted by #5 is a phospholipid.Phospholipids are made up of a glycerol…

Q: n associative learning studies of monkeys, dopaminergic neural activity in the ventral tegmental…

A: Research on primates provides insights on the evolution of humans and the behavior of extinct…

Q: 1. Calculate the genotype frequencies of a population of flowers where the frequency of the CR…

A: A population that is not evolving is said to be at Hardy-Weinberg (H-W) equilibrium. The gene…

Q: What is one of the components of a sustainability revolution? a. consume and throw away…

A: The objective of the question is to identify one of the components of a sustainability revolution…

Q: Gastrin, cholecystokinin, secretin, motilin, and glucose-dependent insulinotropic peptide are…

A: There are endocrine cells all across the gastrointestinal system. These cells produce a wide range…

Q: Please create a phylogenetic (evolutionary) tree given this criteria and follow all points! There…

A: Creating a phylogenetic tree involves various steps that help to depict the evolutionary…

Q: Fig 2 shows gastric organolds cultured from a TffCre; XYZfVfl mouse. Ki67 has been used to identify…

A: Gastric organoids are three-dimensional structures inferred from grown-up or pluripotent stem cells…

Q: Case #6: Which of the tests performed above would NOT be likely to produce a positive result within…

A: In the above scenario, the man complains of dry cough, fever, malaise and anorexia. The patient…

Q: The majority of GWAS associated variants exist in non-coding regions. This has led to additional…

A: Two non-coding mechanisms that contribute to genetic variation and may be associated with non-coding…

Q: List or briefly describe 3 different adaptations that help mammals keep themselves warm 1. 2. 3.

A: Adaptation is a process by which organisms adjust to the environment or changes or processes the…

Q: When cut with Hind III, what size should our GFP fragment be on the gel? Amp-R PGLO Plasmid 5371 bp…

A: When we cut the plasmid with HindIII, a GFP fragment of about 730 bp will be formed.

Q: How can we summarize the results of Nathan and Arianna’s reflexes after drinking coffe

A: After consuming coffее, both Arianna and Nathan еxpеriеncеd changеs in their rеflеx timеs during thе…

Q: Ability of an ecosystem to withstand and recover from disturbances. Organisms that eat and break…

A: Understanding key ecological concepts is fundamental to grasping the intricate dynamics of our…

Q: 3. The figure to the right illustrates an adaptation seen in C4 plants. Describe what is happening…

A: C4 carbon fixation is one of three recognized photosynthetic carbon fixation mechanisms in plants.…

Q: Step 1. Draw five big boxes in a line down the middle of your page along a vertical axis. (see the…

A: In thе visual rеprеsеntation of cеllular rеspiration, a sеriеs of fivе boxеs alignеd along a…

Q: Which of the following are required for glycolysis to take place? Choose one or more: O NAD+ ATP Pi…

A: The objective of the question is to identify the necessary components for the process of glycolysis…

Q: Two pure-breeding lines of petunia plants are crossed. Line 1 plants grow to a height of 54 cm, and…

A: Two pure-breeding lines of petunia plants are crossed.Line 1 plants grow to a height of 54 cm, and…

Q: Which of the following is NOT a property cerebellar Purkinje cells? O They receive climbing fiber…

A: Large neurons called purkinje cells are found in the cerebellum, an area of the brain essential for…

Concept explainers

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.

Topic Video

Question

DNA template strand:
mRNA codons:
tRNA anticodons:
polypeptide:
3' end
5' end
AGC
TTG
TCC
CAT
CGC
ACA
5' end
3' end

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1: Introduction of converting DNA into proteins

VIEW

Step 2: Understanding the formation of polypeptide

VIEW

Solution

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

SPLIT DNA MRNA TRNA Codon Anticodon Amino Acid A T C A T T A T C T A G A
Name (Last, First): DNA An RNA polymerase attaches to the DNA and transcribes the DNA to mRNA Ribosone BIO 340 Activity # 1: DNA and the Central Dogma Complete: DNA Coding 5' ATG TGG ATT CTC AAG ATC AAT AGT 3' DNA template 3 5' Cytoplasm Nuckus Nuclear pore ARNA Use the mRNA codon sequence and the genelic Landelable in order to find the amino acid (AA) sequence of the protein. Example: if mRNA sequence is GUU then the corresponding amino acid 3-letter is Valine (Val) and the corresponding amino acid 1-letter is V. mRNA codon 5' FIRST (5') LETTER tRNA codon 3 U AA 3-letter AA 1-letter Amino acid AA - Amino acid A tRNA THE GENETIC CODE New protein being built U Pie (F) ասա UUC) ԼԱՔ Uva) Lou (L) Leu (L) val (M) Use numbers 1 to 3 to indicate the correct order of the flow of biological information. Translation Replication Transcription Hydroxyl group Deoxyribose sugar DNA's charge is negative due to following (circle the correct one): An alpha helix and a beta sheet in a protein are a type…
FIRST BASE UUU- UUC UUA UUG U CUU- CUC -Phe -Leu DNA Sequence tRNA Sequence (anticodon) -Leu CUA CUG AUU- ACU AUC lle ACC AUA ACA Met or AUG Start ACG- GUU GUC GUA GUG mRNA Sequence (codon) AMINO ACID Sequence SECOND BASE C -Val UCU- UCC UCA UCG- CCU CCC CCA CCG GCU GCC GCA GCG Ser -Pro Thr Ala AAG GAU UAU Cys UAC UAA Stop UGA Stop UAG Stop UGG Trp CAU- CGU -His CAC CGC CAA CGA -Gin CAG CGG AAU- AGU- AAC- AGC AAA- AGA AGG GGU- ASP GGC GGA GGG GAC- GAA GAG UGU- Tyr UGC- Asn Lys G Glu Arg 2 1. In your bag is a specific DNA sequence. 2. Copy that sequence in the box below labeled DNA sequence 3. Transcribe the sequence in the appropriate box. 30 Ser 4. Determine the appropriate anticodon sequence. 5. Translate the appropriate sequence into an amino acid sequence using the codon chart above 6. Using the contents of the bag, create your protein. Arg Gly THIRD BASE
Protein synthesis is a complicated process involving DNA being transcribed to RNA, which is then translated into amino acids. Complete the DNA-to-amino acid table for three consecutive codons with the appropriate nucleotides and amino acids using a codon table. Nucleotide and amino acid options can be used multiple times or not at all. 5' to 3' DNA strand 3' to 5' DNA strand transcribed mRNA tRNA anticodon amino acid arginine cysteine leucine T A U A T G A U arginine leucine A proline T A U Answer Bank A G G с с T T A A U glutamic acid U G C G с с glutamic acid G G G с с G C arginine C G с G
If DNA segments changes from GCATAG to GCATGG, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base A G UUU1 Phenylalanine UCUT UAUT FTyrosine (Tyr) UAC UGU, U FCysteine (Cys) UGCJ UUCJ (Phe) UCC Serine (Ser) UCA U UGA - Stop A UUA1 FLeucine (Leu) UUG- UAA1 FStop UAGJ UCG- UGG - Tryptophan (Trp) G CUU CAU1 CCU1 CGUT Histidine (His) CAC- CUC CCC Proline (Pro) CCA CGC FLeucine (Leu) CUA FArginine (Arg) CGA CAA1 Glutamine A CAGJ (Glu) CGG- CUG- CCG- ACU AAUJ Asparagine AUUT AGUT FSerine (Ser) AGC- U AUC FIsoleucine (lle) ACC AACJ(Asn) Threonine A AUA- (Thr) AAA1 FLysine (Lys) AAG- АСА AGA, FArginine (Arg) AGG- A Start Methionine AUG- (Met) ACG- G GUU GCU, GAU1 Aspartic Acid GGU U GAÇJ(Asp) GUC Fvaline (Val) GUA GCC GGC G Alanine (Ala) GCA Glycine (Gly) A GAAJ Glutamic Acid GGA GAG- (Glu) GUG- GCG- GGG- G
If DNA segments changes from GCATAG to GCATA, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base U A G 0001 Phenylalanine UCU UAU1 Tyrosine (Tyr) UAC UGUT FCcysteine (Cys) UGCJ U UUCJ (Phe) UCC Serine (Ser) UCA U UUA1 UAAT UGA - Stop A FLeucine (Leu) UUG- FStop UAG- UCG- UGG - Tryptophan (Trp) G CU- CCU CGUT CAU1 Histidine (His) CAC U CUC FLeucine (Leu) CUA CC Proline (Pro) CCA CGC FArginine (Arg) CGA CAA1 Glutamine A CAGI (Glu) CGG- CUG- CCG- G AUU AAU1 Asparagine ACU1 AGUT FSerine (Ser) AGC- AUC FIsoleucine (le) ACC Threonir AACJ (Asn) A AUA- ACA (Thr) AAA1 FLysine (Lys) AAG- AGA, FArginine (Arg) AGG- A Start Methionine (Met) ACG- AUG - GUU- GCU GAU- GGU | Aspartic Acid GAÇJ(Asp) U GỤC Valine (Val) GUA GCC FAlanine (Ala) GGC Glycine (Gly) GGA G GAA1 Glutamic Acid A GCA GCG- GAGJ (Glu) GGG- GUG- G
ENE 2: Nose Style DNA Template Strand ATG- GGG- CTT- CTC- TTT MRNA tRNA Amino Acids APPEARANCE
Given the following protein, which of the following sequences of TEMPLATE strand DNA would code for it? Pay attention to the polarity of the polypeptide and the strands of DNA that you choose. Use the codon chart to the right. AUG = met AAA = lys GCU = ala | CUU = leu ACU = thr -lys - thr - ala - leu - met (amino end) 5' TAC GAA CGA TGA TTT TAC ATT 3' 5' ATG CTT GCT ACT AAA ATG TAA 3' (carboxyl end) met 5' TAC TTT TGA CGA GAA TAC ATT 3¹' 3' TAC TTT TGA CGA GAA TAC ATT 5¹ 5' ATG AAA ACT GCT CTT ATG TAA 3¹ 3 TAC GAA CGA TGA TTT TAC ATT 5'
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotidesequences (all belong to an exon):5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the above DNA strand is the template (antisense) strand and the DNA molecule is transcribed that produced a functional mRNA. Assuming there are no mutations, the said mRNA is then brought to the site of protein synthesis,a. what would be the amino acid sequence of the synthesized polypeptide chain?b. how many possible kinds of tRNA molecule that will bring the 2nd amino acid observing wobble hypothesis? List down their anticodons.
DNA DNA Leading strand mRNA tRNA Amino Acid A T G A A A G T C A T T T A G
RNA Write the mRNA and the polypeptide made from the RNA. Translation DNA Template strand Transcription TTT TT TACGGCGTTAGACAAGTGCGTGAGTACACA ATGCCGCAATCTGTTCACGCACTCATGTGT ▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬||
DNA Template: AAC CGA TCC TAT CGG AAA TTT TGC ATG ATC TAT Give the nucleotide sequence after DNA replication, give the mRNA nucleotide sequence, & give the amino acids translated from the mRNA molecule. What is the stop codon in the sequence?