It is S phase of the cell cycle, and time to replicate the cell’s DNA. Using the following strand of DNA as a template, create the complementary strand: GCTCCTTACGGGCCCAATGACCTGAATGTACGAGATCCCATCCTT It is now time to make a protein. Using the same stand of DNA, transcribe it to mRNA, then translate to an amino acid sequence (use the codon table below).

Q: After many cell divisions, a segment as more base pairs than it originally plain what has happened.

A: DNA while replicating for the cell division may get changed in structure according to the type of…

Q: Consider the following DNA sequence: CATGTGTAGTCTAAA. Address the followin questions: AWrite the…

A: In DNA,the genes are present.From these genes mRNA is formed by transcription. This mRNA undergoes…

Q: Numerous Xenopus (frog) cells were exposed to varying amounts of ultraviolet light. Some of the…

A: Cells is the structural and functional unit of human body.  Cells are made of cell orgenlles which…

Q: NA beig sis is a compicated pro cids. Complete the DNA-to-amino acid table for three consecutive…

A: Introduction DNA is a self replicating molecule. mRNA is produced from DNA by a process called…

Q: Given the following stretch of mRNA, what would be the sequence of the corresponding non-template…

A: DNA stands for deoxyribonucleic acid. It is the genetic material of cell.

Q: ext, let's work through the 1st part of the process: TRANSCRIPTION. sing the sequence found in the…

A: The method of copying a part of DNA into RNA is known as transcription. Messenger RNA is made up of…

Q: Match the proteins with their function in DNA replication. unwinds DNA at replication fork forms…

A: The correct matching of proteins with their functions in DNA replication:Unwinds DNA at replication…

Q: Which of the following are true about bacterial DNA replication compared to DNA replication in…

A: Replication is a process in which, with the help of DNA polymerase  enzyme both the strands get…

Q: If protein synthesis was thought of as an analogy of making a pizza, the whole cookbook would be be…

A: Replication is the formation of identical copies of DNA. It occurs in nucleus of the cell.…

Q: Transcribing and translating transcribe and translate the following DNA molecules…

A: DNA (Deoxyribonucleic acid) acts as the hereditary or genetic material of almost all biological…

Q: Give typing answer with explanation and conclusion  True or False   1. DNA regulates Gene Expression…

A: Note: “Since you have posted multiple questions, But as per our Q&A guidelines we can answer 1…

Q: Examine the following sequence of DNA 3’-CTA – TAC – TTA – CGC – GTA – CAT – GCG – TGA – CCC - ACG –…

A: The central dogma is a metabolic process where the  DNA acts as genetic material and transcripted…

Q: the diagram below, a dotted line represents newly-synthesized DNA.  What process is being shown?…

A: DNA replication is a process which is involved in the production of the two identical copies of the…

Q: cleotides                nucleus                      adenine                      cytosine…

A: The process in which DNA forms RNA is called transcription and the process in which RNA forms…

Q: (Select one answer from each dropdown menu:) DNA replication uses as templates to make an Choose…

A: Replication is a process by which two identical copies of DNA are produced. The two new daughter…

Q: Draw replication forks that show what you would expect to see if a cell were unable to make the…

A: Replication is the process of synthesis of new DNA strand from the existing ones. The existing DNA…

Q: The DNA sequence ATGCATGC will pair with which of the following DNA strands? TACGTACG TACCTACC…

A: DNA, or deoxyribonucleic acid, is the hereditary material in humans and virtually all other…

Q: DNA Template: AAC CGA TCC TAT CGG AAA TTT TGC ATG ATC TAT Give the nucleotide sequence after DNA…

A: The replication is the process of new DNA synthesis from the old DNA. The transcription is the…

Q: Below is a short segment of DNA molecule. transcribed the DNA codon into mRNA.…

A: Convertion of TACCATGAGAATTGTGGTCACCTTTTT ATGGTACTCTTAACACCAGTGGAAAAA to mRNA is done and results…

Q: An enzyme is needed for the Krebs Cycle.  It will be made following the directions contained in a…

A: In eukaryotes, the genetic information needed for all cellular processes is encoded by genes, which…

Q: AKS 5c1: The process represented in the model involves the creation of a molecule that is…

A: Transcription is a process that helps convert the information in the DNA strand into RNA in the…

Q: Directions: 1. Use the DNA code to make a replicated copy of DNA. 2. Use the replicated DNA code to…

A: Replication : it is the process where DNA duplicates Transcription: the process of making an RNA…

Q: Using the following coding DNA sequence:TAC GCA CCT TTA GAT CAT AAC TTT GGA ACT1. Write the…

A: Deoxyribose nucleic acid (DNA) is the genetic material composed of four nucleotide bases, namely…

Q: ENE 2: Nose Style DNA Template Strand ATG- GGG- CTT- CTC- TTT MRNA tRNA Amino Acids APPEARANCE

A: Above table is codon anti-codon table for translation of DNA code into protein sequence.

Q: Give the mRNA and the polypeptide (amino acid sequence) that results from the following DNA template…

A: Genetic code, the sequence of nucleotides in deoxyribonucleic acid (DNA) and ribonucleic acid (RNA)…

Q: ANALYSIS 1:Given the following sequence of bases present in the DNA coding strand, what will be the…

A: DNA ( Deoxyribonucleic acid ) is a two stranded ladder like helical structure which functions as…

Q: steps of DNA replication in the order that they occur.

A: First of all we understand what exactly is DNA replication. And what is the main enzyme used in the…

Q: Transcribe the following DNA strand into a MRNA strand. TAC a AUG ATG TAC DIY

A: Transcription is the process by which DNA code of a gene into mRNA code.

Q: ch of the following does not occur during DNA replication? t an answer and submit. For keyboard…

A: Ans - c

Q: Enter the corresponding section of mRNA produced feom the following sections of a DNA template…

A: Template strand also known as anti sense strand is usually formed after the unwinding of DNA…

Q: Template strand/Sense strand Coding strand/Antisense strand Region of DNA unwinding Region of DNA…

A: The sense strand, or template strand, is the only strand that is effectively employed as a template…

Q: The following sequence of DNA is part of the normal, wild-type gene.   5'TAC CGG GAC TTG AGC CGA…

A: A single nucleotide from the DNA is deleted in nucleotide deletion. Although the single nucleotide…

Q: Transcription and Translation For the following strand of DNA, show me the messenger RNA strand and…

A: Messenger RNA (mRNA) carries the genetic information copied from DNA in the form of a series of…

Q: DNA template strand: mRNA codons: tRNA anticodons: polypeptide: 3' end 5' end AGC TTG □ TCC 0 0 0…

A: The method of converting DNA into proteins includes two major steps: transcription and…

Q: The DNA can be increased in size by only about 5%, representing the addition of only 3 kb of new…

A: Cloning vector Based on lambda bacteriophages: Two problems had to be solved before lambda based…

Q: AAA CC GG G CA GG CCGU Phe Gly Arg

A: * Transcription is the process of copying  DNA  segment into RNA. *The DNA segments transcribed into…

Q: Why is DNA replication important to the growth and development of a multi-cellular organism? a of…

A: Introduction :- DNA replication is the process by which a cell makes a copy of its DNA in…

Q: A Section of a Gene TGC GTG TAC CTA CCA For the DNA sequence shown above, identify the following:…

A: The given DNA sequence is as follows,  TGC GTG TAC CTA CCA

Q: Hello,  I have already asked for help with this question but whoever answered it copied the DNA…

A: Gene expression is the conversion of DNA into a biologically functional amino acid polypeptide…

Q: When given the DNA message sequence, 5'-ACT-3', what would be the corresponding DNA template strand…

A: In biology, a DNA strand is the double-stranded molecule of nucleic acid that serves as the…

Q: Determine the complementary DNA strand that would form. Next, write the mRNA that would form from…

A: DNA or deoxyribonucleic acid is a double stranded helical macromolecule that is composed of…

Q: transcription and translation.

A: Answer:  Three general classes of RNA molecules are involved in expressing the genes encoded within…

Q: Replication Separation both No one   The synthesis of the chain goes from the 5 'to the 3' end 2…

A: Replication  means 2 new chains( threads) are synthesized. Sepration means the synthesis of the…

Q: DNA Replication Why cells replicate How to create a complementary DNA strand What enzymes are? Know…

A: DNA replication is the process by which cells replicate their DNA. In this process DNA is used as a…

Oogenesis

The formation of the ovum (mature female gamete) from undifferentiated germ cells is called oogenesis. This process takes place in the ovaries (female gonads). Oogenesis consists of three stages known as the multiplication phase, growth phase, and maturation phase. 

Cell Division

Cell division involves the formation of new daughter cells from the parent cells. It is a part of the cell cycle that takes place in both prokaryotic and eukaryotic organisms. Cell division is required for three main reasons: