Answered: discuss the effect of temperature on…

Name: 1. discuss the effect of temperature on the viscosity of the liquid2.
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 1. discuss the effect of temperature on the viscosity of the liquid2. DNA solution is viscous because of the nature of chemical substance that can intercalate into the DNA helix. An example of such substance is acridine orange. experiments revealed t

Science

Biology

discuss the effect of temperature on the viscosity of the liquid

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter12: Dna: The Carrier Of Genetic Information

Section: Chapter Questions

Problem 8TYU: The statement DNA replicates by a semiconservative mechanism means that (a) only one DNA strand is...

See similar textbooks

Similar questions

4. Propose a two-step procedure to purify protein A from the other molecules (there are multiple answers): Molecule "Protein A" "Protein B" "DNA C" "DNA D" Molecular Weight (kDa) 10.2 65.0 65.0 10.2 pl 8.0 8.0 N/A N/A a. Step 1: I would use (size, cation-exchange, or anion- exchange) chromatography using a pH (a number) buffer. In the space below, sketch a chromatogram, label axes, and label what protein(s) are present in each peak. DO NOT WORRY ABOUT RELATIVE PEAK HEIGHTS. b. Step 2: I would take the (first, second, etc.) peak above and use (size, cation-exchange, or anion-exchange) chromatography using a pH (a number) buffer. In the space below, sketch a chromatogram, label axes and label what protein(s) are present in each peak. DO NOT WORRY ABOUT RELATIVE PEAK HEIGHTS.
2) When DNA is placed in distilled water, which is pH 7.0, it denatures (i.e., the two strands separate). The pH inside a cell is generally 7.2-7.5, depending on the organism, but DNA is generally double-stranded under physiological conditions. Briefly explain, in your own words, why DNA denatures when placed in distilled water but not when it is inside a cell. [Reminder: the pKa for the phosphate groups in the sugar-phosphate backbone of a strand of DNA is 2.14]
4. The base content of a particular DNA molecule is 24% G. What is the percentage of the following bases in the molecule? %A: 5. What is the structural difference between the pentose sugars in DNA and RNA? % T: % C: 6. Why is the AT base pair less stable than the GC base pair?
6. Consider an experiment in which cells are radioactively labeled by this method for only a short period of time (about 30 minutes). The radioactive thymidine medium is then replaced with medium containing unlabeled thymidine, and the cells are grown for some additional time. At different time points after replacement of the medium, cells are examined in a microscope. The fraction of cells in mitosis (which can be easily recognized because their chromosomes are condensed) that have radioactive DNA in their nuclei is then determined and plotted as a function of time after the labeling with radioactive thymidine. labeled mitotic cells (%) 100 75- 50 25 0 bod 0 5 10 15 20 25 30 time (hours) a) Would cells at all phases of the cell cycle contain radioactive DNA immediately after the labeling procedure? Why? b) Why are there initially no mitotic cells that contain radioactive DNA? c) Explain the rise and fall and then rise again of the curve. d) Estimate the length of G2 for these cells e)…
4. Draw the structure of EDTA and how it binds metal ions. Draw the structures of Tris buffer in this experiment, and comment on how they might prevent DNA damage.
3. You isolate DNA from 1 ml of a suspension of E. coli cells using the procedure outlined in your lab handout. After completing the DNA isolation procedure, the total volume of the DNA solution is 600 ul. You transfer 10 µl of this DNA solution into 490 µl of TE buffer to create a diluted DNA solution. Using a spectrophotometer, you determine that the concentration of the diluted DNA solution is 245 ug/ml. a. How much did you dilute the original DNA solution? Express the dilution as a ratio. b. What is the concentration of the original DNA solution? c. How much total DNA did you isolate from the suspension of E. coli cells?
H 1. What type of DNA form (A-form, b-form, Z-form) is represented by the cyan strand in the image? 2. What are the bases that are part of the magenta strand in green plane? (A,T,G,C,U)?
1. DNA plays an important role in two processes. During the process of replication, dna provides information to copy itself, so genetic information can be passed on from one generation of cells to the next. DNA also provides instructions for making proteins, in these instructions are vital to the maintenance and function of cells. DNA provides the information on how to order the amino acids required for making various proteins. Describe the significance of crude extraction of DNA from different sample organismic. 2. Distinguish the importance of the following theorems that are interrelated to the study of bioinformatics: (1) proteomics, (2) genomics, (3) biotechnology, (4) biostatistics, and (5) biological engineering. 3. Describe the procedures that you have encountered in the bacterial identification virtual laboratory (media.hhmi.org). Describe each part of the procedure: (1) simple preparation, (2) PCR amplification, (3) PCR purification, (4) sequencing preparation, (5) DNA…
II. Phoebus Levene (1920s) He is perhaps best known for his incorrect tetranucleotide hypothesis of DNA (DNA was made up of equal amounts of adenine, guanine, cytosine and thymine). He did, however, work to determine the chemical structures of many biochemicals. Specifically, he chemically analyzed DNA and stated it consisted of 3 parts. 2. What are the 3 parts of a nucleotide?
13. a. Draw in the corresponding DNA nucleotide that would base pair with the adenine nucleotide shown below using the same level of detail as provided in the image below. Hint: Remember that DNA bases pair in the antiparallel orientation. орасна you A OH H b. How do you know the adenine nucleotide drawn above is from DNA and not RNA?
3. For this short DNA segment, a. identify the 5' end and the 3' end of the molecule. b. circle the atoms that comprise the backbone of the nucleic acid chain. c. write the nucleotide sequence of this DNA segment. P-OCH, CH, HN OP-OCH, NH, OCH, OH 4. A DNA strand has the sequence ATGGCAATCCTCAAACGCTGT a. What is the sequence of the complementary DNA strand? b. What is the sequence of the mRNA that would be produced during transcription from the original strand of DNA? 5. Write the codon on mRNA that would pair with each tRNA anticodon. a. UUG b. GAA c. UCC d. CAC
Please answer the following questions (Biology) (DNA questions) Where is DNA found in the cell? How does 2m of DNA fit into a cell 0.000 005m in diameter? A person can’t see a single strand of thread from 30m away, but if thousands of those threads are wound together into a rope, they could be seen. How does this statement relate to the DNA you observed? DNA dissolves in water, but not in ethanol. Explain what happened when the ice cold ethanol came in contact with the cell extract during your extraction. If the ethanol was not ice-cold, how would this have affected your collection? What are the potential reasons for extracting DNA from a cell? (Name 3) Do you think scientists would extract human DNA the same way you extracted fruit DNA? Explain. Think about the structural differences between plant and animal cells.