Determine whether each event occurs during initiation, elongation, or termination. Initiation Initiator tRNA enters the P site. Elongation Answer Bank In E. coli, EF-Tu delivers an aminoacyl-tRNA to the ribosome. In prokaryotes, the Shine-Dalgarno sequence pairs with rRNA. The ribosome has mRNA, an empty A site, and a deacylated tRNA in the P site. IF2 dissociates. In E. coli, EF-Tu hydrolyzes GTP. Termination Translocation occurs.
Q: Which of the following is true for translation or protein synthesis in this cell? Select all that…
A: The translation is the process of synthesis of the polypeptide chain that can be taken place in…
Q: A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:…
A: The Central dogma defines how DNA codes for proteins, which occur in three stages: replication,…
Q: EF-Ts factor regenerates EF-Tu/GDP from EF-Tu/GTP for the next round of elongation cycle in…
A: Introduction The Central Dogma states the formation of RNA from DNA and proteins from RNA. The…
Q: The covalent attachment of an amino acid to a tRNA is an endergonic reaction. In other words, it…
A: Introduction In the protein translation process, the key role is played by the tRNA which…
Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome…
A: Gene expression is a process by which the genes are turned on to form RNA and proteins. This is seen…
Q: Indicate which of the following items are associated with transcription or translation. This could…
A:
Q: In eukaryotes, the initial transcript, pre-mRNA, must be modified in three ways before it leaves the…
A: The premature mRNA (pre-mRNA) are produced from the DNA template strand within the nucleus of…
Q: In bacteria, researchers have isolated strains that carry mutations within tRNA genes. These…
A: Codon is located on mRNA while anticodon is on tRNA. Anticodons specifically identifies and pair to…
Q: Drag the functions involved in the bacterial translation process into the appropriate box with the…
A: IF1 Answer : Prevents entry of an amino acyl trna into the ribosomeA site during the early initial…
Q: A mutation is found in a tRNA-encoding gene. The wild type (non-mutant) allele (version) produces a…
A: tRNA (transfer RNA) is a type of RNA that helps decode the genetic information in mRNA to build…
Q: Which statement about nonsense mediated decay (NMD) is false? detects mRNAs containing premature…
A: "Since you have asked multiple questions, we will solve the first question for you. if you want any…
Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome…
A: A ribosome is a biological unit made up of RNA and protein that functions as the cell's protein…
Q: Determine whether each event occurs during initiation, elongation, or termination. Initiation…
A: During translation, ribosomes move along the mRNA strand, reading the genetic code and using it to…
Q: Imagine you are going to label a gene associated with apoptosis in Symbiodiniaceae with a Yellow…
A: Splicing is the post transcriptional modification where intron (non coding part of gene) will be…
Q: What will be the overall anti-codon sequence in tRNA for this mRNA?…
A: Proteins are synthesized from DNA in two step process. These two processes are transcription and…
Q: How does the antibiotic streptomycin inhibit bacterial translation? Multiple Choice blocks…
A: Translation Translation involves the answer of information in mrna molecules into the amino acid…
Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome…
A: Ribosomes are the protein synthesizing machinery present in a cell. A protein is synthesized during…
Q: Splice sites on mRNAs are located with the help of all of the following EXCEPT: Question 9…
A: Introns are cut off at splice sites along a pre-mRNA sequence, and exons are connected at these…
Q: Explain the function of spliceosomes in eukaryotic cells. The following sequence represents pre-mRNA…
A: Translation is the process of synthesis of protein from mRNA . So , RNA serves as a template . But ,…
Q: Vaccina virus (used in the polio vaccine) produces an enzyme that takes the 5’ cap off of the mRNAs…
A: The 5'-G caping is only found in the eukaryotic mRNA. This is the result of post transcriptional…
Q: ) Identify the current stage of the translation process shown in Figure 1 and name the anticodon…
A: Translation is a orocess in which mRNA produce protein by the help of ribosome and tRNA.there are…
Q: In eukaryotes, why is the initial RNA transcript usually longer than the mature mRNA molecule?…
A: Transcription is the process by which messenger rna is made from DNA. This process takes place…
Q: "Place the following prokaryotic translation events in order: translocation, binding of initiator…
A: The correct answer to this particular question will be, assembly of small and large ribosomal…
Q: Which of the following interactions in E. coli ensures that the start codon of an mRNA is accurately…
A: The translation is the process of producing protein mRNA as a template and peptidyl activity of the…
Q: Select all of the factors in the list below that play a role in the translation initiation of…
A: Translation : It is the process in which ribosomes in the cytoplasm or endoplasmic reticulum…
Q: Which of the following characterize RNA polymerase Il transcriptional termination in eukaryotes?…
A: Transcription: Transcription is a step by step process by which the information stored in a strand…
Q: identify start/end site, which amino acid will be on the tRNA that is the first to bind to the A…
A: Transcription is the process which comprises of synthesis of mRNA from the DNA inside the nucleus of…
Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome…
A: A ribosome is a biological unit made up of RNA and protein that functions as the cell's protein…
Q: Identify the correct recognition site for ribosomal subunit binding during translation. the 30s…
A: A process of protein synthesis is known as translation. The translation process contains three steps…
Q: The flu virus maximizes the use of its limited (13.5 kb) genome by using alternative translation…
A: Virus are mostly pathogenic forms which neither considered to be living or non-living outside the…
Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome…
A: Central dogma of life involves gene expression, or the flow of genetic information from genes to…
Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome…
A: The start codon is the first codon of an mRNA (messenger RNA ) transcript translated by a ribosome.…
Q: Consider the wobble rules listed in Table 15.2. Which of the following mRNA codons will bind to the…
A: Protein translation is the process of molecular biology in which the mRNA synthesized by the process…
Q: tRNAs are 'charged' or activated by aminoacyl TRNA synthetases. Select the correct statements…
A: Since you have asked multiple questions , we will solve the first question for you. If you want any…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- identify start/end site, which amino acid will be on the tRNA that is the first to bind to the A site of ribosome, anticodon on the tRNA in the P site of the ribosome when release factor bings to A site, and what amino acid sequence of the protein that will be formed from mRNA? Here is the mRNA sequence:5'GUUUCCCGUAUACAUGCGUGCCGGGGGCCCGUUACCAGGCCUCAUUAUUGGAUAACGGAAAAAAAAAAAAA3'Determine whether each event occurs during initiation, elongation, or termination. Initiation Peptidyl transferase transfers the peptidyl group to water. In E. coli, EF-Tu hydrolyzes GTP. Elongation In E. coli, mRNA binds to the 30S ribosomal subunit. Answer Bank In prokaryotes, the Shine-Dalgarno sequence pairs with rRNA. In E. coli, EF-Tu delivers an aminoacyl-tRNA to the ribosome. Termination Translocation occurs. Initiator tRNA enters the P site.Describe the prokaryotic translation initiation shown in the diagram. Define the convention of protein synthesis (directionality of synthesis) as well as the meaning of the A, P, and E sites of the ribosome.
- How does the antibiotic streptomycin inhibit bacterial translation? Multiple Choice blocks elongation by preventing the large ribosomal subunit from binding to the small ribosomal subunit interferes with the normal pairing of aminoacyl TRNAS and codons resulting in abnormal proteins prevents the release of the initiator tRNA from the P site, blocking elongation blocks termination by competitively inhibiting the binding of a release factor to the A siteDrag the functions involved in the bacterial translation process into the appropriate box with the corresponding name of the translation factor or component. Reset Help Prevents premature association of the large ribosomal subunit with the small Serves as the MRNA binding site for Guides the initiator fMet-tRNA into the the small ribosomal subunit. P site. ribosomal subunit. Prevents entry of an amino-acyl tRNA into the ribosome A site during the early initiation stages. Assists incoming amino-acyl RNA into the A site. IF1 IF2 IF3 EF-Tu Shine-Dalgarno sequenceThe flu virus maximizes the use of its limited (13.5 kb) genome by using alternative translation initiation sites, overlapping reading frames, and ribosomal frameshifting. For example, part of the viral PA gene includes a rarely used CGU codon. When the ribosome pauses to translate this codon, it may slip ahead by one nucleotide and produce a polypeptide with a diff erent C-terminal sequence. From the partial mRNA sequence shown here, determine the normal polypeptide sequence and the sequence with the frameshift.
- A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:Strand A - TACGATGACGATAAGCGACATAGC - Strand B - ATGCTACTGCTATTCGCTGTATCG -Which is the transcribed (template) strand? Write the sequence of the resulting mRNA transcript. Add labels to the strands above to show the 3’ and 5’ ends.will give ratingSeveral experiments were conducted to obtain information about how the eukaryotic ribosome recognizes the AUG start codon. In one experiment, the gene that encodes methionine initiator tRNA (tRNAiMet) was located and changed; specifically, the nucleotides that specify the anticodon on tRNAi Met were mutated so that the anticodon in the tRNA was 5′ –CCA–3′ instead of 5′ –CAU–3′. When this mutated gene was placed in a eukaryotic cell, protein synthesis took place, but the proteins produced were abnormal. Some of these proteins contained extra amino acids, and others contained fewer amino acids than normal. a. What do these results indicate about how the ribosome recognizes the starting point for translation in eukaryotic cells? Explain your reasoning. b. If the same experiment had been conducted on bacterial cells, what results would you expect? c. Explain why some of the proteins produced contained extra amino acids while others contained fewer amino acids than normal
- Which of the triplets below is a possible anticodon for a tRNA that transports Leucine (Leu) to a ribosome? Second letter C UGU cys UCU1 UCC UCA UCG UAU Tyr UACS Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUU UGCS Phe UUC U UUA UUG FLeu CAU HiS CGU] CUU CUC Leu CCU ССС CCA CCGJ CACS CGC Arg CGA CAA GIn Pro C CUA CUG J CAG S CGG AUU AUC lle AUA AAU Asn AGU ser ACU АСС Thr ACA AAC AAA ys AGA Arg AAG J AGC AUG Met ACG Lys AGG J GUU GUC CUA Val GAU ASP GCU GACJ GCC FAla GGU] GGC CGA Gly CCA C CAA M UCAG Third letter UCAG UCAG First letterIndicate which of the following items are associated with transcription or translation. This could be in prokaryotes or eukaryotes, or both. Group of answer choices: Translation OR Transcription Sigma binds to the promoter mRNA binds to the small ribosomal subunit Spliceosomes remove introns and splice together exons Nucleotides are added from the 5' to 3' end tRNA anticodon binds to the corresponding mRNA codon STOP codon results in terminationSeveral experiments were conducted to obtain information about how the eukaryotic ribosome recognizes the AUG start codon. In one experiment, the gene that encodes methionine initiator tRNA (tRNAiMet) was located and changed; specifically, the nucleotides that specify the anticodon on tRNAiMet were mutated so that the anticodon in the tRNA was 5′ –CCA–3′ instead of 5′ –CAU–3′. When this mutated gene was placed in a eukaryotic cell, protein synthesis took place, but the proteins produced were abnormal. Some of these proteins contained extra amino acids, and others contained fewer amino acids than normal. Q. What do these results indicate about how the ribosome recognizes the starting point for translation in eukaryotic cells? Explain your reasoning.