Determine the effect of the following mutations on the DNA sequence. In each case, the mutation is described after the sequence (REFER TO THE SUPPLEMENTAL DOCUMENT FOR GUIDANCE TO THIS QUESTION).   Guanine nucleotide (G shown in red below) was deleted from the DNA sequence at the position indicated by the arrow). Write out the sequence of the mutated DNA and the protein made from it.  What is the effect of this mutation on the protein? (For example, how will the mutation affect the length and sequence of the protein?  What about the function of the protein?)

Q: The code for a fully functional protein is actually coming from an mRNA transcript that has…

A: Introduction :- mRNA stands for messenger RNA. The nucleus uses the nucleotide sequence of DNA as a…

Q: Match the following Characteristic to their proper Mutation:   Question 4 options:  CHOICES: 1.…

A: Mutations change the sequence of nucleotide bases and hence results in phenotypic and genotypic…

Q: What is the resulting polypeptide: _______________________________________________________? What…

A: Mutation in a gene sequence causes encoding of a mutated protein. This mutated protein will have…

Q: Silent mutations that occur in DNA are quite common in living cells and usually involve no effects…

A: A gene mutation is a permanent alteration that makes up a gene in the DNA sequence so that the…

Q: c) What are essential fatty acids? What type of geometrical isomerism plays a vital role in…

A: In the recent two decades or more, lipid research in the life sciences has regained popularity,…

Q: Tm value, the GC-content of the selected DNA sequence and the absolute nucleotide composition of the…

A: DNA stands for deoxyribonucleic acid and it consists of 4 types of nitrogen bases, adenine, guanine,…

Q: type of mutation

A: If the sequence was mutated from CACGTAAAG to become CACCGTAAAG; single nucleotide insertion…

Q: Protein folding

A: Proteins are composed of some 20 types of amino acid residues, and they would be more or less alike…

Q: Pompe disease is a rare genetic condition resulting from a deficiency of the protein…

A: Pompe disease is a genetic disorder that involves the accumulation of glycogen inside the cells.…

Q: What basal transcription factor unwinds the DNA during transcription initiation? Aside from…

A: Basal transcription factor is that protein which bind to a DNA sequence which helps in initiation of…

Q: If the sequence of mRNA is 5'-AAUCGUACGGAUGCCGAAAUACCCAUUAGGGAUUGCAUAGCGAGCAACGGAC-3', what is the…

A: Protein is the final product of a gene that determine the phenotype of the organism. Protein…

Q: Lactose permease, a protein of E. coli, is composed of a singlepolypeptide that is 417 amino acids…

A: Translation is the process by which the protein is synthesized by reading the codons in mRNA. The…

Q: Based on the following wild type DNA sequence, indicate if each of the mutations should be…

A: The central dogma is DNA --> mRNA --> Protein. Hence, any mutations in the DNA lead to changes…

Q: The illumina method of sequencing uses a unique type of nucleotide building block. What is the…

A: The illumina sequencing is a DNA sequencing method used to determine single nucleotide bases of a…

Q: The following RNA sequence represents a small messenger which can be translated in a prokaryotic…

A: The first step in translating an RNA sequence into a protein is to divide the sequence into codons,…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: You are studying the toxic protein called ectatomin, a major component of ant venom (specifically…

A: Proteins contain amino acids. They are linked to each other by peptide bonds. The amino acid such as…

Q: Consider a stretch of DNA (a hypothetical gene) that has the sequence 5’ ATG-CTA-TCA-TGG-TTC-TAA 3’…

A: Gene is the basic unit of heredity. All living organisms contain nucleic acid in their nucleus as…

Q: What are the sequences of all the possibletripeptides that contain the amino acids aspartic acid,…

A: Amino acids are the building blocks of proteins. They contain amino group, carboxyl group, and…

Q: Find non-cancerous, non--nonsense, point mutation genetic disease. Describe the disease's name and…

A: A point mutation is a mutation that only affects a single nucleotide of nucleic acid. It occurs most…

Q: B. Using the DNA sequence above, write a new DNA sequence from 3’ to 5’ that incorporates a…

A: A silent mutation is a type of mutation that occurs in DNA where a single nucleotide is changed, but…

Q: For each of the following sequences, fill in either the DNA, the mRNA sequence, or the amino acid…

A: The given mRNA sequence: AUG ACU AGC UGG GGG UAU UAC UUU UAG  The corresponding DNA sequence will be…

Q: Part of being a detective is being able to decode secret messages left behind by certain…

A: The given DNA sequence is: 5'- TATGCTAGGCATTGTCGTAGGCATACG -3' 3'- ATACGATCCGTAACAGCATCCGTATGC -5'

Q: DNA mutations can affect the reading frame for the genetic code. What is a human condition caused by…

A: Mutations are the changes in the genome resulting in synthesis of different products. These changes…

Q: Ôn the space provided, type the translation product of wild-type gene A (use three- letter…

A:

Q: Shown below is a portion of a DNA sequence ( 31 base pairs long ) that encodes the last amino acids…

A: The process of synthesis of messenger RNA with the help of template DNA strand is called…

Q: The following eukaryotic DNA sequence is a made up gene. It is a mutated variant from the one that…

A: The genetic framework is a collection of instructions used by living cells to decipher data encoded…

Q: The code for a fully functional protein is actually coming from an mRNA transcript that has…

A: The process of synthesis of proteins from mRNA is called as translation while the process of…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: 5’ GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG 3'  From above sequence…

Q: Protein X can be covalently modified with many methyl groups. What two general properties would be…

A: Histone methylation is mechanistically related to other forms of histone modifications including…

Q: The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to…

A: Replication is the process of the formation of identical copies of DNA. It takes place in the…

Q: Identify the type of mutation present in the CDS and discuss the implications on the protein.

A: Mutations are random alteration in the DNA structure which leads to mis-reading of Information on…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.